Главная   |   Древние Рода   |   ДНК тесты   |   ДОК генеалогия             VK  |  OK  |  FB

Здравствуйте, гость ( Вход | Регистрация )



4 страниц V  < 1 2 3 4 >  
Ответить в данную темуНачать новую тему
> Гаплoгрупа A И Mrca Современного Человека, MRCA современного человека
kosmonomad
сообщение 6.12.2011, 17:07
Сообщение #21


Магистр
******

Группа: R1a, Магистры
Сообщений: 2622
Регистрация: 4.10.2009
Из: Москва
Пользователь №: 2401



Цитата(aklyosov @ 6.12.2011, 17:56) *
Я попробовал влезть в геном и найти М91, но там черт ногу сломит. Может, кто знает? В списке ISOGG расшифровки М91 нет, в отличие от других.

У Томаса есть все
http://ymap.ftdna.com/cgi-bin/gb2/gbrowse/hs_chrY/
вот здесь М91
http://ymap.ftdna.com/cgi-bin/gb2/gbrowse_...ymap%3Adatabase


--------------------
Y-DNA: R1a>Z283>Z280>CTS1211>YP1019>YP1033+ BY27605+ Central-Eurasian-2, R1a1a1b1a2b
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 6.12.2011, 18:09
Сообщение #22


Легенда
************

Группа: R1a, Академики
Сообщений: 6929
Регистрация: 24.2.2009
Пользователь №: 1721



Цитата(aklyosov @ 6.12.2011, 22:56) *
То есть в локусе М91 у них есть 8-ми нуклеотидный прогон тимина. Да даже это они толком не написали. Написали "8-нуклеотидный участок длинного поли-тимина". Так длинный полимерный участок, или только 8 нуклеотидов? Но штука в том, что М91, насколько я помню, это не повтор тимина 8 раз. Я попробовал влезть в геном и найти М91, но там черт ногу сломит. Может, кто знает? В списке ISOGG расшифровки М91 нет, в отличие от других.


Цитата(kosmonomad @ 6.12.2011, 23:07) *
Цитата(aklyosov @ 6.12.2011, 17:56) *
Я попробовал влезть в геном и найти М91, но там черт ногу сломит. Может, кто знает? В списке ISOGG расшифровки М91 нет, в отличие от других.

У Томаса есть все
http://ymap.ftdna.com/cgi-bin/gb2/gbrowse/hs_chrY/
вот здесь М91
http://ymap.ftdna.com/cgi-bin/gb2/gbrowse_...ymap%3Adatabase

Вадим, спасибо за ссылку. Вот описание снипа М91

Цитата
Name: M91
Type: snp
Description:
Source: M
Position: ChrY:20366926..20366926 (+ strand)
Length: 1
ISOGG_haplogroup: A
Mutation: 9T to 8T
YCC_haplogroup: A
allele_anc: ins
allele_der: del
comments: B9.87a
count_derived: 28
count_tested: 318
primer_f: GAGCTTGGACTTTAGGACGG
primer_r: AAACTTTAAGGCACTTCTGGC
primary_id: 44797
gbrowse_dbid: ymap:database

То есть, это индель-мутация, что в гаплогруппе А проявляется как прогон 8-ми тиминов, как и написано в статье.

Однако, возникает странная ситуация. В проектах FTDNA встречаются такие комбинации снипов (курсивом отмечены те, что предполагаются из анализа STR):
M91+, P97+, P108+, V151-, V168-, V171-(N38376) - A1*
M91+, P97+, P108+, V151+, V171- (N71150) - A1b
M91+, P97+, P108+, V168+, V171+ (180250) - A1a
M91+, P97+, P108-, V151-, V171+, , V221+, V50+ (181787) - A2
M91-, P97-, Р108-, V168+, V221+ (152884) - R1a1a1

Как состыковать наличие снипов V168 и V211 как у носителей M91/P97, так и у тех, у кого эти снипы отстутствуют? Если считать V168 и V211 общими для всех современных людей, то что делать с носителями A1* и A1b, у которых там минус? Получается, возможны любые комбинации M91 и V168, кроме обоих минусов, так что иерархия летит кувырком. Кто-нибудь пробовал в этом разобраться?


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 6.12.2011, 20:40
Сообщение #23


Легенда
************

Группа: R1a, Академики
Сообщений: 6929
Регистрация: 24.2.2009
Пользователь №: 1721



Вот данные по снипу P97
Цитата
Name: P97
Type: snp
Description:
Source: PS
Position: ChrY:13395667..13395667 (+ strand)
Length: 1
ISOGG_haplogroup: BT
Mutation: G to T
YCC_haplogroup: BT
allele_anc: G
allele_der: T
comments: DFFRY AluY50 Chimp has G in this position but most humans T
count_derived: 587
count_tested: 591
primer_f: TGGAGGGTAAGTGAGTAG
primer_r: TTTTAATGGAACACCGTAG
primary_id: 43011
gbrowse_dbid: ymap:database


У участников WTA из гаплогруппы R1a1, как, скорее всего, и у всех остальных, кроме представителя A3b2 из Саудовской Аравии, в снипе М91 отмечено ins (т.е. 9Т в ряд), в снипе Р97 - Т. У всех ранее тестированных представителей гаплогруппы А там del (8T) и G.

Поскольку знак плюс или минус для снипа - это дело соглашения, то ничто не мешает присвоить положительные (т.е. мутировавшие от предка) значения М91-ins и Р97-Т. Тогда для гаплогруппы А они будут отрицательными, а для ВТ - положительными. Иными словами, они оказываются эквивалентными ранее определенным Р42 и SRY10831.1, что маркируют гаплогруппы ВТ.

Тем самым снимается противоречие из предыдущего сообщения, и при таком "переформатировании" мы наблюдаем следующую лесенку из представителей проектов FTDNA:

P108-, V151-, V168-, V171-, M91-, P97- (N38376) - A1*
P108-, V151+, V171-, M91-, P97- (N71150) - A1b
P108-, V168+, V171+, M91-, P97- (180250) - A1a
P108+, V151-, V171+, V221+, V50+, M91-, P97- (181787) - A2
.
.
.
Р108+, V168+, V221+, M91+, P97+ (152884) - R1a1a1

В этой схеме точно такая же смена знака проделана со снипом Р108 (T->C в позиции 13935642), что задает гаплогруппу А1. Снипы, сменившие знак, отмечены цветом. То есть, там действительно идет лесенка с той же самой шкалой времен, что была определена ранее. Предок "альфа"-гаплогруппы (в этой схеме она соответствует А1) как жил 160 тыс. лет назад или раньше, так и остается, но положение вилки между А и ВТ нужно уточнять.


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 7.12.2011, 7:19
Сообщение #24


Легенда
************

Группа: R1a, Академики
Сообщений: 6929
Регистрация: 24.2.2009
Пользователь №: 1721



Обратите внимание на верхнюю ступеньку в этой лестнице, которую занимает афроамериканец N38376 с минусом ПО ВСЕМ снипам, что у него исследовались. В схеме Cruciani эта ступенька отсутствует, там дерево укореняется по снипам V151 (et al) и V171 (et al.), и в его списке нет гаплотипов, где бы эти оба снипа были отрицательны. То есть, в коммерческой базе данных обнаружился представитель еще более древней ветви, чем те, о которых сообщалось в недавней статье Cruciani.

Насколько я знаю из переписки с администратором проекта гаплогруппы А, М. Хаммер и Т. Карафет уже в курсе об этой находке, а N38376 планируют исследовать в программе WTY, как только найдут спонсора. Надо сказать, что носитель этого гаплотипа не одинок - по STR к нему примыкают, по моим данным, еще 9 гаплотипов длиной 25 и более маркеров из США (4), Ганы (2), Ямайки, Колумбии и Панамы. Их общий предок приходится примерно на 4 тыс. лет назад. Значит, предками современных жителей Нового Света из этого списка были выходцы из разных этнических групп Западной Африки, а не кто-то один или группа близких родственников. В противном случае, мы бы имели всего несколько сот лет назад вглубь.

Помимо этой явно древней ветви, еще предстоит позиционитовать камерунцев с DYS438=16, по которым пока лишь известно, что они не из "бета"-гаплогруппы. Там тоже не исключены сюрпризы.


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
Stanislaw
сообщение 7.12.2011, 18:23
Сообщение #25


Знаток
****

Группа:  R1a
Сообщений: 635
Регистрация: 24.10.2009
Пользователь №: 2444



Цитата(Igor1961 @ 7.12.2011, 7:19) *
Обратите внимание на верхнюю ступеньку в этой лестнице, которую занимает афроамериканец N38376 с минусом ПО ВСЕМ снипам, что у него исследовались. В схеме Cruciani эта ступенька отсутствует, там дерево укореняется по снипам V151 (et al) и V171 (et al.), и в его списке нет гаплотипов, где бы эти оба снипа были отрицательны. То есть, в коммерческой базе данных обнаружился представитель еще более древней ветви, чем те, о которых сообщалось в недавней статье Cruciani.

Насколько я знаю из переписки с администратором проекта гаплогруппы А, М. Хаммер и Т. Карафет уже в курсе об этой находке, а N38376 планируют исследовать в программе WTY, как только найдут спонсора. Надо сказать, что носитель этого гаплотипа не одинок - по STR к нему примыкают, по моим данным, еще 9 гаплотипов длиной 25 и более маркеров из США (4), Ганы (2), Ямайки, Колумбии и Панамы. Их общий предок приходится примерно на 4 тыс. лет назад. Значит, предками современных жителей Нового Света из этого списка были выходцы из разных этнических групп Западной Африки, а не кто-то один или группа близких родственников. В противном случае, мы бы имели всего несколько сот лет назад вглубь.

Помимо этой явно древней ветви, еще предстоит позиционитовать камерунцев с DYS438=16, по которым пока лишь известно, что они не из "бета"-гаплогруппы. Там тоже не исключены сюрпризы.

Уважаемый Игорь, я выражаю признание и большое спасибо за точное и прозрачное познакомление проблемы гаплoгрупы А.
Как видно, все впереди!





--------------------
Y-DNA: R1a
mt-DNA: ? (Unknown)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 8.12.2011, 1:17
Сообщение #26


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Цитата(Stanislaw @ 7.12.2011, 10:23) *
Уважаемый Игорь, я выражаю признание и большое спасибо за точное и прозрачное познакомление проблемы гаплoгрупы А.


Ну наконец-то уважаемый Stanislaw понял, что мы не вышли из Африки. И что мы не произошли из гаплогруппы А. И что с самой гаплогруппой А раздрай, и что ни Крусиани, ни Карафет, ни Кран пока не знают, как свести концы с концами в гаплогруппе А.

Думаю, уважаемый Stanislaw, Вам стоит взять пример с Вашего коллеги Larry Mayka, который понял, что ошибался, и публично об этом объявил. И это делает ему честь.

А история была проста. Я поместил на форуме RootsWeb расчеты по субкладу E-V13, которые показали, что общий предок жил примерно 3500 лет назад. Larry возразил, что он провел расчеты по программе Nordtvedt и получил между 6000 и 9000 лет, что сходится c возрастом ископаемого E-V13 (7000 лет).

Я прокомментировал, что "квадратичная" программа Nordtvedt должна завышать результаты счета, назвал расчет Larry "абсурдом" и предложил пересчитать. Позавчера Larry объявил, что, действительно, программа Nordtvedt сильно завышает данные, поскольку считает все подряд - и recLOH, и нулевые мутации, и мультикопийные маркеры - все принимая за нормальные мутации. Larry пересчитал и получил 3400 лет до общего предка субклада E-V13. После этого он принес публичные извинения, и сообщил, что мои расчеты полностью подтвердились.

Понимаете, уважаемый Stanislaw, как работают Ваши старшие коллеги? Вот это и есть научная честность.


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 8.12.2011, 2:19
Сообщение #27


Легенда
************

Группа: R1a, Академики
Сообщений: 6929
Регистрация: 24.2.2009
Пользователь №: 1721



Цитата(aklyosov @ 8.12.2011, 7:17) *
И что с самой гаплогруппой А раздрай, и что ни Крусиани, ни Карафет, ни Кран пока не знают, как свести концы с концами в гаплогруппе А.

Концы с концами сходятся, причем очень изящно, если принять в качестве предковых значений G для Р97, del для М91 и C для Р108. По обычному в SNP-филогении соглашению, предковый нуклеотид соответствует знаку минус в таблице снипов, и, значит, у всех представителей ВТ (Р97-Т, М91-ins, Р108-Т) там будут плюсы. То есть не у нас нет африканских снипов, а у африканцев нет наших. При такой трактовке схемы Cruciani и Карафет складываются в одно целое, как это показано в примере выше.

По этой схеме, снипы М91 и Р97 оказываются эквивалентами Р42 и SRY10831.1. Чтобы экспериментально опровергнуть такое отнесение, нужно найти гаплотипы, что дают 3 комбинации из 4-х возможных: М91+/Р42+, М91-/Р42-, М91+/Р42- и М91-/Р42+. Если систематически получаются лишь 2 из них, то снипы эквивалентны, и схема с предковой гаплогруппой А1 верна по состоянию на сегодняшний день.


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 8.12.2011, 3:06
Сообщение #28


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Цитата(Igor1961 @ 7.12.2011, 18:19) *
По этой схеме, снипы М91 и Р97 оказываются эквивалентами Р42 и SRY10831.1


Что-то я не улавливаю. Р42 это вообще снип субклада D2a1a. SRY10831 долгое время назад активно обсуждался и мусолился со всех сторон. У африканцев его нет, а у нас он есть. Какая же здесь эквивалентность? У гаплогруппы А есть М91, а у нас ее нет. Какая же здесь эквивалентность?

Подробно обсуждалось, что SRY10831 есть у приматов, а в гаплогруппе А он отсутствует. Пришли к выводу, что он повторился два раза, но в обратную сторону, и опять выскочил в гаплогруппе R1al, но не в R1b. Какая же здесь эквивалентность с М91?


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 8.12.2011, 4:50
Сообщение #29


Легенда
************

Группа: R1a, Академики
Сообщений: 6929
Регистрация: 24.2.2009
Пользователь №: 1721



Цитата(aklyosov @ 8.12.2011, 9:06) *
Цитата(Igor1961 @ 7.12.2011, 18:19) *
По этой схеме, снипы М91 и Р97 оказываются эквивалентами Р42 и SRY10831.1


Что-то я не улавливаю. Р42 это вообще снип субклада D2a1a. SRY10831 долгое время назад активно обсуждался и мусолился со всех сторон. У африканцев его нет, а у нас он есть. Какая же здесь эквивалентность? У гаплогруппы А есть М91, а у нас ее нет. Какая же здесь эквивалентность?

Прошу прощения, снип гаплогруппы ВТ писал по памяти, перепутал буквы. Имел а виду М42, что отрицателен у всех носителей гаплогруппы А.

По поводу эквивалентности снипов, вот какие ПЕРВИЧНЫЕ результаты тестирования мы имеем для участников проектов гаплогруппы А и WTY-R1a1:

SNP________Hg A___WTY-R1a1
M42_________A______T
SRY10831____T______T
M91_______8T(del)_9T(ins)
P97_________G______T


Со снипом SRY10831 ситуация известная, гаплогруппу ВТ маркирует С в этой позиции, просто сейчас нет на руках первичных данных. Эквивалентность М91 и Р97, кажется, подтверждаиется на всех известных на сегодняшний день примерах. Значит, задача по доказательству неэквивалентности снипов М91/Р97 и М42/SRY10831.1 сводится к поиску гаплотипов, у которых А в М42 сочетается с девяткой Т (ins) в М91 и/или Т в Р97.

Иными словами, по текущей классификации такие гаплотипы не дожны относиться ни к гаплогруппе А, ни к ВТ. Если таковых нет, то Р97, М91, М42 и SRY10831.1 следует считать неразличимыми по своему положению на древе гаплогрупп. Насколько мне известно, таких гаплотипов пока не найдено. Среди людей, во всяком случае. По результатам тестирования носителей гаплогруппы А, снипы М91 (del) и Р97 (G) подтверждаются даже для самых далеко отстоящих гаплотипов, что дают разбег на сотни тысяч лет и различаются по снипам V серии. Специально пишу сам нуклеотид, чтобы не сбивать с толку плюсами и минусами, которые суть результат соглашения.

Собственно, из этого анализа я и сделал вывод, что в текущей версии ISOGG гаплогруппа А соответствует М91-/Р97-, а ВТ, соответственно, М91+/Р97+, если подходить строго к конвенции, что считать плюсом, а что минусом. В пользу такого отнесения говорит и ремарка Томаса к снипу Р97:"Chimp has G in this position but most humans T." Мost humans - это представители "бета"-гаплогруппы.

Аналогичными соображениями руководствовался и при смене знака у снипа Р108, что также задал головоломку для ISOGG. Если так не сделать, то пазл упорно отказывается собираться. Отсюда получается, что "альфа"-гаплогруппа и А1 (Р108 Т) в той лесенке, что привел выше - это одно и то же. Все остальные линии - производные от нее. По состоянию на сегодняшний день, во всяком случае.

P.S. Чтобы не бегать от поста к посту, повторяю лесенку субкладов А, как она видится с учетом этого анализа:

P108-, V151-, V168-, V171-, M91-, P97- (N38376) - A1*
P108-, V151+, V171-, M91-, P97- (N71150) - A1b
P108-, V168+, V171+, M91-, P97- (180250) - A1a
P108+, V151-, V171+, V221+, V50+, M91-, P97- (181787) - A2
!
!
Р108+, V168+, V221+, M91+, P97+ (152884) - R1a1a1

В скобках указаны номера китов с проекта гаплогруппы А. При анализе гаплотипа N71150 были привлечены данные из статьи о Багамских островах, где в качестве доказанного A1b был приведен очень близкий 17-маркерных гаплотип. В качестве представителя всего остального человечества высупил наш kosmonomad, за что ему большая благодарность.


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 8.12.2011, 5:17
Сообщение #30


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Цитата(Igor1961 @ 7.12.2011, 20:50) *
Отсюда получается, что "альфа"-гаплогруппа и А1 в той лесенке, что привел выше - это одно и то же. Все остальные линии - производные от нее. По состоянию на сегодняшний день, во всяком случае.


Вот против этого никаких возражений нет. Или, по крайней мере, это пока ничему не противоречит. Они, правда, могут уйти еще глубже по времени, чем альфа-гаплогруппа, но мы этого пока не знаем.

Тогда получается, что примерно 160 тысяч лет назад (возможно, окажется и раньше) где-то обитала альфа-гаплогруппа. Где - мы не знаем. От нее отпочковалась гаплогруппа А (с выжившим снипом М91), и в итоге ушла в Африку, где сейчас и находится. Мы - не их предки. Потом отпочковалась бета-гаплогруппа, от которой и произошли, в частности, европеоиды, но дистанция в 100 тысяч лет между альфа- и бета-гаплогруппой наводит на мысль, что что-то там было, но пропало. 60 тысяч лет назад было некое бутылочное горлышко, из которого наши предки вышли уже вполне развитыми современными людьми. Думаю, что они были и до того, но почти все сгинули в результате чего-то катастрофического.

Потому мы - не потомки гаплогруппы А и не имеем их снипов, а у них, естественно, нет наших снипов.

Тогда все байки, что мы вышли из Африки потому что там "наибольшее разнообразие" там и остаются байками. Разнообразие там по двум основным причинам. Первая - то, что африканцы действительно древнее, их гаплогруппа А сидит в Африке от 80 до 120 тысяч лет, а мы, совершенно отдельная ветвь, вышли из бутылочного горлышка всего 64 тысячи лет назад. Естественно, у нас разнообразие меньше. Но не потому, что он африканцев произошли, а потому, что они, африканцы - старший брат. А братья один из другого не происходят.

Вторая причина разнообразия в Африке - это то, что там смешались гаплогруппы А и В. Они отстоят друг от друга совершенно далеко, потому что А - от альфа-гаплогруппы, а В - от бета-гаплогруппы. И когда они смешались, то "разнообразие" резко увеличилось. А попгенетикам все равно, что измерять. Они берут А и В, и говорят - ууу, какое разнообразие.

Поэтому аргумент "разнообразия" здесь - это профанация. Оно не определяет кто от кого произошел.

То же самое - любимый аргумент попгенетиков, что "при удалении от Африки разнообразие падает". Естественно, падает, в какую сторону ни пойти. Но падает не потому, что в Африке прародина, а потому, что там смесь А и В. Перешла R1a в Сибирь - вот и дистанция от Африки большая, и разнообразие (R1a) малое, но не потому, что R1a из Африки вышла, а потому что гаплогруппа молодая.

Все эти фантазии попгенетиков на уровне детского сада. Типа "если Х меньше чем Y, значит Х произошло от Y".

"Если шахматисты меньше баскетболистов, то шахматисты от баскетболистов произошли".


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 8.12.2011, 6:01
Сообщение #31


Легенда
************

Группа: R1a, Академики
Сообщений: 6929
Регистрация: 24.2.2009
Пользователь №: 1721



Цитата(aklyosov @ 8.12.2011, 11:17) *
Тогда получается, что примерно 160 тысяч лет назад (возможно, окажется и раньше) где-то обитала альфа-гаплогруппа. Где - мы не знаем. От нее отпочковалась гаплогруппа А (с выжившим снипом М91), и в итоге ушла в Африку, где сейчас и находится.

Строго говоря, гаплогруппа А в той формулировке, что сейчас принята, отсутствует в обновленной схеме, как таковая. Есть чрезвычайно далеко отстоящие друг от друга А2, А3, возможно, еще какие-то, и в их ряду "бета"-гаплогруппа. Так что об "отпочковании" речь пока не идет.

Снип М91 определяет гаплоруппу очень широко, как все те линии, что несут 8 тиминов подряд в позиции 20366926. А несут эту комбинацию все те, у кого также имеется аденин в М42 и гуанин в Р97. Все 3 снипа находятся в одной связке, что привязана ВТ. По сути, гаплогруппа А определена "от противного", как не ВТ. Женщин тоже можно определить как всех тех, кто не относится к мужчинам. По сути верно, если не вдаваться в тонкие детали, но информативно ли?


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
BeLah
сообщение 8.12.2011, 12:26
Сообщение #32


Участник
**

Группа:  Y - ???
Сообщений: 249
Регистрация: 17.10.2009
Пользователь №: 2419



по снипу М91:
у шимпанзе---9Т
у африканцев ---8Т
у неафриканцев(ВТ)---9Т

Кручиани предположил,что здесь было две мутации:
1) переход 9Т>8T от шимпанзе к африканцам
2) обратная мутация 8Т>9T от африканцев к BT

Чтобы подтвердить это предположение,он исключил М91,ввел новые снипы серии V и построил новое дерево,по которому:

ВТ потомок А2-Т
А2-Т потомок А1-Т
А1-Т потомок альфы

и никаких противоречий.
Перейти в начало страницы
 
+Цитировать сообщение
Stanislaw
сообщение 8.12.2011, 14:25
Сообщение #33


Знаток
****

Группа:  R1a
Сообщений: 635
Регистрация: 24.10.2009
Пользователь №: 2444



WTY N38376: L898! (от Bonnie)


--------------------
Y-DNA: R1a
mt-DNA: ? (Unknown)
Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 8.12.2011, 15:02
Сообщение #34


Легенда
************

Группа: R1a, Академики
Сообщений: 6929
Регистрация: 24.2.2009
Пользователь №: 1721



Цитата(Stanislaw @ 8.12.2011, 20:25) *
WTY N38376: L898! (от Bonie)

Because something is happening here
But you don’t know what it is
Do you, Mister Jones?

Боб Дилан "Ballad Of A Thin Man" smile.gif


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 8.12.2011, 18:05
Сообщение #35


Легенда
************

Группа: R1a, Академики
Сообщений: 6929
Регистрация: 24.2.2009
Пользователь №: 1721



Цитата(BeLah @ 8.12.2011, 18:26) *
по снипу М91:
у шимпанзе---9Т
у африканцев ---8Т
у неафриканцев(ВТ)---9Т

Кручиани предположил,что здесь было две мутации:
1) переход 9Т>8T от шимпанзе к африканцам
2) обратная мутация 8Т>9T от африканцев к BT

Чтобы подтвердить это предположение,он исключил М91,ввел новые снипы серии V и построил новое дерево,по которому:

ВТ потомок А2-Т
А2-Т потомок А1-Т
А1-Т потомок альфы

и никаких противоречий.

Ничего исключать не надо, потому что схемы Кручиани и Карафет прекрасно накладываются одна на другую, как можно видеть из таблички ключевых снипов.



Строки, отмеченные как A1b, A1a, A2 и A3, содержат данные из статьи Cruciani, численные символы соответствуют номерам китов с гаплогруппного проекта FTDNA, Bahamas - это снипы гаплотипа с Багамских островов из статьи Simms et al., почти в точности совпадающего с N71150 из проекта. В качестве образца для сравнения приведены данные по тем же снипам участников проекта WTY из гаплогруппы R1a1, любезно предоставленные уважаемым Боромиром.

Эта схема складывается при условии, что снипы М91, Р97 и М42 эквивалентны. В любом другом варианте идут нестыковки. Пока еще мало точек соприкосновения между обеими схемами в "субкладах" А2 и А3, но в целом взаимное расположение ветвей восстанавливается неплохо. На драфте Томаса Крана выложена та же самая схема ветвления (А2, А3 и ВТ веером от А1), но сделано это несколько невнятно, легко запутаться. Судя по наличию гаплотипа N38376 с родственниками, не укладывающимися в схему с А1а и A1b, одними этими ветвями дело не ограничивается.

Гаплотипы, приведенные в таблице, расходятся друг с другом на колоссальное количество мутаций даже в сверхмедленных форматах, причем без намека на группирование. Подсчет "в лоб" дает уже упоминавшиеся 160 тыс. лет до их общего предка. Сколько на деле, покажут расчеты по длинным гаплотипам, когда будут сделаны соответствующие апгрейды.


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
Stanislaw
сообщение 8.12.2011, 20:35
Сообщение #36


Знаток
****

Группа:  R1a
Сообщений: 635
Регистрация: 24.10.2009
Пользователь №: 2444



Цитата(Igor1961 @ 8.12.2011, 19:05) *
На драфте Томаса Крана выложена та же самая схема ветвления (А2, А3 и ВТ веером от А1), но сделано это несколько невнятно, легко запутаться.
Судя по наличию гаплотипа N38376 с родственниками, не укладывающимися в схему с А1а и A1b, одними этими ветвями дело не ограничивается.

Bначале дискуссии уже я писал , что еще нет снипа хромосомного Адама, который прошел бы на всеx потомков, а чтобы его нет у Шимпанзе.
Еще его не открыли.
У Cruciani - Root пустой, без снипа!
Работы с снипами еще много. Во всей вертикали гаплoгрупы R примерно 100 снипов: 100 SNP на 25 тысяч лета.
Итак сколько снипoв должнo быть в нескольких знать вертикалях гаплoгрупы A на примерно 100-120 тысяч лет?



--------------------
Y-DNA: R1a
mt-DNA: ? (Unknown)
Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 9.12.2011, 5:02
Сообщение #37


Легенда
************

Группа: R1a, Академики
Сообщений: 6929
Регистрация: 24.2.2009
Пользователь №: 1721



Цитата(Stanislaw @ 9.12.2011, 2:35) *
Bначале дискуссии уже я писал , что еще нет снипа хромосомного Адама, который прошел бы на всеx потомков, а чтобы его нет у Шимпанзе.

Если Вы внимательно рассмотрите таблицу подтвержденных снипов из предыдущего сообщения, то нет и снипа гаплогруппы А. Ее отнесение по М91-del и Р97-G сделано "от противного", примерно как античные греки считали определяющим признаком варваров отсутствие у них признаков эллинов.

Самый "глубокий" из известных сейчас снипов, это, видимо, Р108, что разделяет древнейшие линии (А1 в текущей нотации) и все остальные. Взаимное расположение ветвей с Р108-С и время до их общего предка, строго говоря, оценить очень сложно из-за скудости данных и колоссального разброса в мутациях. "Субклады" А1а и A1b на схемах Кручиани и Крана - это наверняка лишь небольшой фрагмент более сложного древа. В опубликованные деревья не попадают несколько УЖЕ известных, но недостаточно охарактеризованных линий. Слово "субклады" даю в кавычках, потому что по иерархии их правильнее называть макро-гаплогруппами.


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 9.12.2011, 8:33
Сообщение #38


Легенда
************

Группа: R1a, Академики
Сообщений: 6929
Регистрация: 24.2.2009
Пользователь №: 1721



Рассмотрим текущую ситуацию со снипами М91 и Р97 подробнее. Для этого доствточно рассмотреть снипы P108/V221 (эквивалентные для данного набора) и М91/Р97 (также эквивалентная пара).

Экспериментально подтверждены следующие их комбинации:

____________P108 / V221____M91 / P97
A1*/A1a/A1b____C / G________8T / G
A2/A3__________A / T________8T / G
BT_____________A / T________9T / T

Каких-то других вариантов пока не найдено, насколько мне известно. Наша задача - опознать, какая из этих четверок содержит предковые значения снипов, а какие - производные от нее. По законам комбинаторики их всего 3:

Вариант 1. ВТ --> A2/A3 --> A1*/A1a/A1b
Вариант 2. ВТ <-- A2/A3 --> A1*/A1a/A1b
Вариант 3. ВТ <-- A2/A3 <-- A1*/A1a/A1b

Первый из них соответствует дереву ISOGG-2010, в котором в качестве предковых снипов для М91 и Р97 записаны 9Т и Т, соответственно. Третий - это дерево Cruciani-2011, где те же снипы в ВТ оказываются производными. Второй - это примерно то, что получается в расчетах пана Станислава с далеко отстоящим от остальных субкладом А3. В нем, как и в третьем варианте, М91/Р97 в "бета"-гаплогруппе производные от предковых 8T / G.

Как выбрать наиболее вероятную последовательность? Если не привлекать дополнительную инфоримацию, они абсолютно равноправны. За неимением прямых данных по ископаемой ДНК, следует, очевидно, рассмотреть, каким временем датируются предки этих генеалогических линий. Для сводной гаплогруппы ВТ это порядка 60 тыс. лет назад, для А2/А3, к сожалению, недостаточно данных для такой оценки, а предок A1*/A1a/A1b убегает в глубокую древность - не менее 150 тыс. лет назад по пока еще фрагментарным данным. Достаточно взглянуть на первые 6 маркеров 22-маркерных сверхмедленных панелей у их носителей:

12 12 11 -- 10 11 -- 11 Ghana
12 13 10 -- 10 11 -- 10 USA (black)
12 12 14 -- 11 12 -- 14 Cameroon
12 10 11 -- 7 13 -- 8 Guinea-Bissau
13 11 12 -- 10 11 -- 16 Cameroon

Если представить дерево гаплогрупп в виде матрешки, где "дочки" вкладываются внутрь, то более обоснованным смотрится 3-й вариант с предковыми 8Т/G для снипов М91/Р97. С другой стороны, мы пока слишком мало знаем о ветвях А2 и А3, чтобы заведомо исключить из рассмотрения 2-й вариант.

Наконец, явно реликтовый характер ветвей А1 вполне сочетается с предположением, что в лице этих представителей Западной Африки мы встречаем осколок какой-то очень древней популяции, исчезнувшей повсюду, кроме этих мест, котрые по своим природным ландшфтам можно считать реликтом доледниковой эры. По данным палеоботаники, зона лесов там никогда не исчезала, даже во времена ледниковых максимумов. Родился общий предок этих людей в районе Гвинейского залива или совсем в другом месте, мы не знаем. Во всяком случае, костных останков такого возраста там пока не находили, так что мы даже не знаем, была ли это популяция анатомически современных людей или они относились к какой-то другой ветви..


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
Right & Midfield
сообщение 13.2.2012, 14:19
Сообщение #39


Новичок
*

Группа:  Y - ???
Сообщений: 27
Регистрация: 13.2.2012
Из: Moscow
Пользователь №: 3715



Цитата(BeLah @ 8.12.2011, 13:26) *
Кручиани предположил,что здесь было две мутации:
- переход 9Т>8T от шимпанзе к африканцам
- обратная мутация 8Т>9T от африканцев к BT
Чтобы подтвердить это предположение,он исключил М91,
ввел новые снипы серии V и построил новое дерево

1. На наш взгляд - Fulvio Cruciani попытался изящно "притянуть за уши" группу BT к группе A.
Для этого он "предположил" про SNP то, что Вы показали,
и вдогонку - удревнил обе гаплогруппы так, чтобы они "уехали" за точку катастрофы Тоба.
Ибо ему так легче получается объяснить, что "всё из атомов" и "все мы из Африки".

Однако, мы считаем, что периодически происходящие катастрофы, при которых всё живое проходит сквозь "игольное ушко" - приводят к тому, что живое выживает локально, т.е. в убежищах. Общий первопредок мог быть откуда угодно, хоть из единого континента Гондваны,
но группы людей, выжившие в разных убежищах - не обязательно являются предками/потомками друг друга. Fulvio Cruciani это тоже прекрасно понимает, но пытается навязать нам иное:
группа BT - потомок группы A.

2. Для этого он сознательно вводит в формулы расчётов MRCA - значительно завышенный коэффициент возраста поколения - 30 лет. Это допустимо лишь для последнего времени, да и то - не для всего человечества, а только для стран "большой восьмёрки" ... "большой двадцатки". И совершенно недопустимо для периода 40-140 тлн, когда люди жили значительно меньше, оставляли потомство значительно раньше. Возможно, что возраст поколения в те времена - был 20 лет, или даже ещё меньше.

Но если группы BT и A значительно моложе, чем у Fulvio Cruciani, то они совершенно точно пережидали катастрофу Тоба - в разных географических убежищах! И это сильно мешает Fulvio Cruciani - связать их между собой отношениями "предок-потомок", ведь гораздо логичнее предположить отношения "два брата от одного предка". Кстати, в женской части ДНК-генеалогии - картина сходная: группы MN тоже non-african, т.е. можно полагать, что женские группы MN пережидали катастрофу Тоба вместе с мужскими группами BT. Сходная картина и в Африке: есть одна отдельно стоящая женская группа L0 (аналог мужской A0), есть несколько групп L1-L6 (аналог мужских A1-A3), и есть точно такая же проблема "присаживания" non-african групп MN - к африканскому дереву (аналогия ситуации с мужской BT).

3. То что Fulvio Cruciani вытворяет с деревом SNP - наводит на мысль, что он очень боится некой обратной гипотезы, а именно:
SNP M91 - сквозной от шимпанзе к группе BT. Эта группа - и есть центральный ствол человечества. От ствола периодически отходят другие группы, и отправляются погулять, в том числе и в Африку. У некоторых групп - потом даже и M91 исчезает, например у группы A. Это разумеется возможно.

Более того: теоретически - аналогичная мутация может произойти у любого из нас, причём в любой момент, в любой гаплогруппе. Но это же не STR, это SNP !!!
т.е. вероятность такого события - очень мала. За всю историю рода Homo - это произошло лишь однажды (у группы A). И уж обратная мутация SNP у той же самой !!! группы, да ещё почти сразу же (по временнЫм меркам) после прямой мутации - это ничтожно малая вероятность. Это как если бы мы подкинули десять миллионов нуклеотидов в воздух, и один из них - не упал, а воздухе завис; а затем мы подкинули десять миллионов нуклеотидов ещё раз, и (о чудо) - в воздухе завис ... тот же самый нуклеотид.

4. Если копнуть ещё глубже, т.е. почитать первоисточники, на которые ссылается Fulvio Cruciani,
то выясняется, что все его слова о "нестабильности" SNP M91 - не более чем "наукообразие", проще говоря - лапша на уши. Выясняется, что и возраст 30 лет и возможность мутации SNP "туда-сюда" - он якобы обосновывает вот этой работой:
http://www.cell.com/current-biology/fullte...9822(09)01454-7

Которая разумеется о совсем другом, а не о возможности мутаций SNP "туда-сюда",
и вообще - очень спорна и по сути и по исполнению.
Т.е. для оправдания своей догматики - Fulvio Cruciani нашёл работу, где просто наблюдается совпадение с его собственной догматикой по цифре скорости 3.0 х 10-8. Самое забавное, что в указанной работе возраст поколения 30 лет - показан на двух СОВРЕМЕННЫХ людях.
Т.е. мы возвращаемся к нашим же баранам: категорически нельзя переносить образ жизни современных людей, в том числе и тот факт, что современные люди затягивают с рождением детей - на древние времена, когда люди жили совсем по другому.

5. Негативное впечатление от работы Fulvio Cruciani ещё и в том, что он не просто "изящно сфальсифицировал" - он ещё и указал метОду для последователей, для дальнейшей догматизации ДНК-генеалогии. Он ведь не девочка, впервые услышавшая про "митохондриальную Еву" - он понимает, что гаплотипов становится всё больше, в том числе и в корневых группах A и BT; он понимает, что постепенно выявляются очень редкие гаплотипы в этих группах. И вот для того чтобы последователи - нечаянно не обнаружили коренное противоречие на основе самостоятельного анализа новых редких гаплотипов - Fulvio Cruciani предлагает метод "присаживания" группы BT на дерево группы A.


--------------------
Macro Genetic Genealogy
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 14.2.2012, 2:52
Сообщение #40


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Хммм... Кто Вы, доктор Зорге? (С)

Рассмотрение проведено вполне грамотно, и наводит на мысль, что здесь не случайный новичок.

Только вчера и сегодня я немного порубился именно по этому вопросу на форуме RootsWeb. В качестве спарринга выступали администратор Проекта FTDNA по гаплогруппе А Bonnie Shrack, наш старый знакомый Mayka, немного Ken Nordtvedt, но на этот раз он был даже где-то на моей стороне, хотя ему быть на чьей-то стороне что соляной кислоты напиться. Ну, и по мелочам.

Так вот, статья Крусиани при всей ее полезности обнаружения новых снипов вреда принесла немало. В общем, что Вы здесь и пишете.

Майка повторяет, что Крусиани вообще сделал гигантский вклад и всем обхяснил про гаплогруппу А. С другой стороны, Бонни считает, что у него не хватило смелости назвать вещи своими именами, и он накуролесил с введением и дроблением субкладов, запутав всю картину. Она высказала положение, что всю гаплогруппу А сейчас переделали, и что она перестала быть той, что была, и сейчас представляет наслоение многих субкладов, и что ее вообще-то уже не стоит называть гаплогруппой А, но приходится. Но она (гаплогруппа) ясно показывает, что все люди произошли от африканцев, потому что снипы этой новой "гаплогруппы А" есть у всех гаплогрупп.

Короче, в точности подтвердилось то, что я предсказывал ранней осенью. А именно то, что чтобы спасти положение и продолжать говорить, что все произошли от гаплогруппы А, а значит (!) от африканцев, гаплогруппу А удревнили до альфа-гаплогруппы, и, естественно, ТЕ снипы есть у всех. Могли бы удревнить до шимпанзе, и тогда точно все бы произошли из Африки.

Вот так и Бонни сейчас утверждает, что сначала бьыла гаплогруппа А, по умолчанию африканская, от нее произошла гаплогруппа ВТ, вот и снипы налицо (показываются снипы альфа-гаплогруппы), а от ВТ и все остальные. Гаплогруппа В, естственно, тоже по мнинию Бонни произошла от А.

Я задал Бонни простой вопрос - если В произошла от А, то какое между ними временное расстояние? Ведь должно быть небольшое, если В действительно из А? Вот, говорю, Бонни, когда ответите, тогда продолжим. Они исчезла, и со вчерашнего дня не появляется. Думает, наверное. А это - мат в один ход. Она не знает, что между ними дистанция в 100 тысяч лет, и даже немного больше. То же самое между А и любой другой гаплогруппой. Они просто не могли произойти от А.

Посмотрим, что будет дальше. Все затихли и перестали эту тему обсуждать. Видимо, ждут ответа Бонни.





--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение

4 страниц V  < 1 2 3 4 >
Быстрый ответОтветить в данную темуНачать новую тему
1 чел. читают эту тему (гостей: 1, скрытых пользователей: 0)
Пользователей: 0

 

              Mantlet IPB skin Designed by Fisana, IPBskins.ru
RSS Текстовая версия Сейчас: 24.10.2019, 0:34
 
     




Генеалогический сайт Рунета Сайт Всероссийского Генеалогического Древа Генеалогическая сеть Анализ фамилий Cайт рода R1a Краеведческий сайт Чеченский ДНК проект


© 2004-2015 RODSTVO.RU