Версия для печати темы

Нажмите сюда для просмотра этой темы в обычном формате

Rodstvo.ru _ Рода A и B _ Обновленное Генеалогическое Дерево Гаплoгрупы A И Современного Человека.

Автор: Stanislaw 7.7.2012, 14:47

Обновленное генеалогическое дерево гаплoгрупы A и современного человека.



или в pdf.
http://www.tropie.tarnow.opoka.org.pl/adam_root2012.pdf

Во вертикали А0 учли SNPs:
Jones, Dorsey, Simms, Boon и "Bakola" (по Cruciani).

Автор: Igor1961 7.7.2012, 15:34

Все логично. И чем оно принципиально отличается от дерева, построенного по 22-маркерной панели STR?

http://www.rodstvo.ru/forum/index.php?act=attach&type=post&id=951

Топология одна и та же, при этом дерево STR дает более аккуратные датировки.

Автор: aklyosov 7.7.2012, 17:12

Цитата(Stanislaw @ 7.7.2012, 6:47) *
Обновленное генеалогическое дерево гагаплoгрупы A и современного человека.


Нормальное дерево, мы с ним давно работаем. Только это дерево не "гаплогруппы А и современного человека", там все мутации получены от современных людей. И там не "гаплогруппа А", а серия гаплогрупп. Остальное все верно:-))

Но есть вопросы:

1. Кто конкретно имел именно гаплогруппу А1, имя?

2. Кто конкретно имел гаплогруппу А1b, имя?

3. Если таких не было, на каком основании разделены А1 и А1b?

4. Почему М91 в ВТ, а не в левой ветви? Для ответа посмотрите на предковую последовательность снипа и на ту же в ВТ и в левой ветви. Впрочем,в списке ISOGG вы его не найдете, он удобно пропущен.


Автор: Люда 7.7.2012, 23:27

Да, отличий практически никаких. Я увидела из основных - Р305 и L986 переместились в А1. Я об этом писала еще 24.4 и 9.5.2012
Сообщение #187
...
3) Не понимаю, почему Р305 снип А0, по-моему он должен быть в А1.
4) Не вижу в Табл. L986. На схеме он в А0, а должен быть в А1 (найден в А0 -"G", у шимпанзе "А").

Бедный Перри, он так и остался один.

Автор: Люда 8.7.2012, 0:38

P.S. Присмотрелась, внутри А0 перетасовались группы. Почему-то L1005 cтал снипом А1, хотя у шимп. и чел.последовательности в базе данных в этой позиции одинаковый нуклеотид - А.

Автор: aklyosov 8.7.2012, 2:11

Цитата(Люда @ 7.7.2012, 15:27) *
Да, отличий практически никаких. Я увидела из основных - Р305 и L986 переместились в А1.


Да, дерево уже подправлено. P305 у них еще совсем недавно был в А0, теперь уже в А1. Наша критика возымела действие. То же и с L986.

Надеюсь, получу ответ на свои вопросы выше.

Занятно, что "Адам" заметно постарел. Интересно. как теперь адепты ISOGG определяют его возраст.

Еще интересно то, что неандертальны не были чернокожими, как и неафриканцы (альфа-гаплогруппа). То есть при расхождении предков неандертальцев и хомо сапиенс обе линии были нечернокожими, и обе были не в Африке.

А вот А0 были, видимо, чернокожими. То есть это какая-то параллельная линия, которая идет даже древнее неандертальцев.

Еще занятно то, что бушмены (гаплогруппа В, как я понимаю), тоже нечернокожие.

Автор: Igor1961 8.7.2012, 7:58

Цитата(aklyosov @ 8.7.2012, 8:11) *
Еще занятно то, что бушмены (гаплогруппа В, как я понимаю), тоже нечернокожие.

Как раз среди бушменов гаплогруппа В встречается относительно редко. В последней по времени http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2988483/?tool=pmcentrez T. Naidoo et al. Development of a single base extension method to resolve Y chromosome haplogroups in sub-Saharan African populations Investig Genet. 2010; 1: 6 есть статистика по 183 бушменам Южной Африки (Table 3). Детали сбора образцов и племенная принадлежность их носителей не уточняются, но, исходя из современной численности этого народа (около 100 тыс. человек), такая выборка соответствует примерно одному образцу на 275 человек. То есть, покрытие очень плотное.

Из этих 183 человек 52 (28,4 %) дали положительный тест на снип М51. Это A1b1b2a в текущей версии ISOGG. К ним можно добавить носителей снипов М14 (A1b1a1a) - 5 чел., M114 (A1b1a1a1a) - 8 чел., и P28 (A1b1a1a1b) - 16 чел. Итого, представители гаплогрупп, объединенных под A1b1, собирают 44.3 % бушменов из выборки. У их ближайших соседей - банту Южной Африки, в этом же исследовании нашли 5 % (17 из 343) представителей гаплогруппы A1b1b2a. Очевидно, следствие метисации и ассимиляции, что, несомненно, имела место за долгое время соседства. Достаточно взглянуть на портрет Н. Манделы,
коса (xhosa, первый звук - щелчок) по национальности.

На втором месте идут различные субклады, нисходящие к E1b1a: М2 (E1b1a) - 24 чел., M58 (E1b1a1a1a) - 2 чел., M154 (E1b1a1a1g1c) - 2 чел., М191 (E1b1a1a1f1a) - 14 чел. Все вместе они набирают 23,0 % от выборки. С большой долей уверенности происхождение этих линий можно связать с метисацией бушменов окружавшими их, и намного более превосходящими по численности банту. Среди них этот же набор снипов дал 66 %.

На третьем - 29 человек (15,8 %) со снипом M35. Это гаплогруппа E1b1b1, характерная для жителей Средиземноморья и Африканского Рога, но весьма редкая в субсахарской Африке (1,5 % у банту Южной Африки в том же исследовании).

Лишь затем следуют 13 человек (7,1 %) со снипом Р6 (B2b1), к которым примыкают обладатели снипов M112 (B2b*) - 2 чел., и Р8 (B2b4a) - 5 чел. Итого получается 10,9 % представителей гаплогруппы B2b, практически отсутствующей в выборке южноафриканских банту (1 из 343). Среди последних с частотой 16 % встречается другой субклад - B2a1a (M152).

Из оставшиеся 10-ти человек 6 или 7 - явные потомки европейских поселенцев из гаплогрупп I (M170) - 1, R1a1a (M198) - 2, и R1b (M343) - 3. 300 лет совместного проживания и распространенная практика бурских фермеров брать себе наложниц из местного населения не могли не сказаться. Один носитель снипа M34 (E1b1b1b2a1) может, в принципе, оказаться как потомком белого иммигранта, так и одним из членов ветви, маркированной М35.

Наконец, трое - представители гаплогруппы Е2, встречающейс с частотой 10,2 % у южноафриканских банту. Очевидно, от последних и досталась.

Итого, специфичечески койсанскими линиями в этой выборке можно назвать A1b1, B2b и E1b1b1, которые вместе собирают 71 % выборки южноафриканских бушменов. Последняя группа дала отрицательные результаты по нисходящим снипам M78 (E1b1b1a1), M148 (E1b1b1a1c1), M81 (E1b1b1b1a), M107 (E1b1b1b1a1 - private), M165 (E1b1b1b1a2a - private), M123 (E1b1b1b2a), M34 (E1b1b1b2a1), M136 (E1b1b1b2a1a1) и M281 (E1b1b2), что уводит ее общего предка с европейскими и ближневосточными ветвями того же субклада, как минимум, на 12000 лет назад.

В этой весьма репрезентативной выборке (см. выше) не были обнаружены гаплотипы А0, что ставит под сомнение популярное утверждение, что бушмены - потомки самых ранних людей. Их необычайно большая вариативность - следствие наложения нескольких далеко разошедшихся линий, производных от альфа-гаплогруппы, а вовсе не знак того, что эта этническая группа какая-то особенно древняя.

Где и когда они перемешались, дав в итоге современную популяцию койсанских народов, мы не знаем. Если исходить из того, что гаплоруппы A1b1 и E1b1b1 весьма характерны для юга Аравийского п-ва и Африканского Рога, то по имеющимся данным можно предположить, что предки бушменов сформировались где-то в этом районе между 15 и 12 тыс. лет назад, и лишь затем мигрировали на юг Африки. Встретили ли они там других людей и смешались с ними, или те уже вымерли к тому времени, мы не знаем. Бесспорно лишь, что за этой миграцией последовал долгий период изоляции (вплоть до появления скотоводов банту в начале нашей эры), в течение которого "вымылись" другие генеалогические линии. В свою очередь, сохранились те, что оказались минорными во времена неолитической революции на Ближнем Востоке, и исчезли там.

Так что имеющиеся данные по Y хромосоме койсанских народов не дают никакй дополнительной поддержки гипотезе Out-of-Africa. Все логично объясняется без привлечения ее постулатов.

Автор: Люда 8.7.2012, 9:12

Перри пока никуда не определили, но ведь 28(по моим подсчетам) из его снипов должны перейти в А1.

Автор: bugler 8.7.2012, 17:15

Цитата(aklyosov @ 8.7.2012, 3:11) *
Цитата(Люда @ 7.7.2012, 15:27) *
Да, отличий практически никаких. Я увидела из основных - Р305 и L986 переместились в А1.


....
Еще интересно то, что неандертальны не были чернокожими, как и неафриканцы (альфа-гаплогруппа). То есть при расхождении предков неандертальцев и хомо сапиенс обе линии были нечернокожими, и обе были не в Африке.

А вот А0 были, видимо, чернокожими. То есть это какая-то параллельная линия, которая идет даже древнее неандертальцев.

Еще занятно то, что бушмены (гаплогруппа В, как я понимаю), тоже нечернокожие.


Я думаю, что и А0 не были чернокожими (или точнее негроидами). Это всё пре-палеантропы. Или гейдельбергский человек в своих проявлениях. Неандерталец это специализированная форма гейдельбергца, а A0 - африканская форма, жившая в наиболее благоприятных условиях ( возле тропиков). Альфа-гаплогруппа, скорее всего, с Ближнего Востока, где условия были более жёсткие. Отсюда и шёл исход в Африку, Европу и Азию. Расообразование началось где-то 40 тыс.лет назад.

Автор: aklyosov 8.7.2012, 17:45

Цитата(bugler @ 8.7.2012, 9:15) *
Расообразование началось где-то 40 тыс.лет назад.


Так не получается, если следовать ряду положений антропологов. По их понятиям, лопатовидным резцам у монголоидов не менее миллиона лет. Если так, то расы были сотни тысяч лет, но передача их носителям мужских гаплогрупп видна как только недавняя. Думаю, это фокусы бутылочных горлышек. Более того, в передаче расовых признаков участвовали женщины, которые на нашем дереве не отражены.

Автор: Odin 8.7.2012, 18:19

Ладони всех людей светлые, у Неандертальцев головная коробка была больше чем у Сапиенса-Сапиенса, возможно Неандертальцы потеснили Сапиенса-Сапиенса в Африку.

Автор: bugler 8.7.2012, 19:25

Цитата(aklyosov @ 8.7.2012, 18:45) *
Цитата(bugler @ 8.7.2012, 9:15) *
Расообразование началось где-то 40 тыс.лет назад.


... По их понятиям, лопатовидным резцам у монголоидов не менее миллиона лет. Если так, то расы были сотни тысяч лет, но передача их носителям мужских гаплогрупп видна как только недавняя. Думаю, это фокусы бутылочных горлышек. Более того, в передаче расовых признаков участвовали женщины, которые на нашем дереве не отражены.


Да! Так получается, когда антропологи оценивают одни признаки и замалчивают о других.Если оценка ведётся комплексно, отталкиваясь от современных значений (минимум- максимум, исключая паталогию), то негроиды в Африке появились не ранее 40 тыс.лет. А монголоиды в Центральной Азии и того меньше (время зависит от заселения Америки, т.к. там переходная форма монголоидов). Причём в Австралии признаки более европеоидные, чем в других местах.
Таким образом оценка опять зависит от масштаба измерений.
А женщины, безусловно, внесли свой вклад. Стоит вспомнить таримские мумии.

Автор: bugler 8.7.2012, 19:37

Цитата(Odin @ 8.7.2012, 19:19) *
Ладони всех людей светлые, у Неандертальцев головная коробка была больше чем у Сапиенса-Сапиенса, возможно Неандертальцы потеснили Сапиенса-Сапиенса в Африку.

Да нет! Неандертальцы "классические" это специализированная форма. Такие формы образуются при значительной изоляции популяции. Умеренный климат и специализация охотника на крупную дичь увела их в сторону. Сейчас спорят об их видовой обособленности, но твёрдых доказательств нет. Возможно отдельные популяции и отделились от вида Homo, но не все. Они могли участвовать в антропогенезе в районе Передней Азии, чему есть некоторые предпосылки. Безусловно то, что мозги у них работали по другому, так как орудия мустье связываются с ними однозначно.
А неандертальцы "атипичные" это гейдельбергский человек в своём многообразии. Ашельская индустрия.

Автор: Stanislaw 8.7.2012, 20:11

Цитата
Топология одна и та же, при этом дерево STR дает более аккуратные датировки.
1) Датировки были бы более аккуратные, если бы была возможность считания всех мутаций СТР. Hа дороге симуляции выступил и такой случай, что из пяти мутаций между двумя гаплoтыпами выявилась только одна, так как все оставшееся четыре были идеально палялельнэ.
2) Программный ”1000 геномов” в сфере 24 миллионов пар принципов выявили в каждом образце в среднем 18,700 SNP. это над 2 SNP на поколение. А счет SNP не представляет собой такой проблемы как мутации STR. SNP кроме того однозначно показывает первого предка.

Цитата
1. Кто конкретно имел именно гаплогруппу А1, имя?
2. Кто конкретно имел гаплогруппу А1b, имя?
3. Если таких не было, на каком основании разделены А1 и А1b?

На что нужное вам имя, если Kahn и WTY их не публикуют?
1) Снипы гаплoгрупы A1 мы имеем все: почти все aфыканьцы и все гаплoгрупы неафрыканьские.
Мы своe им знаем...
21 SNP в гаплoгрупе А1 общее (bottleneck?), прежде чем возникло разветвление (coalescentia) популяции.
2) Гаплогруппу А1b конкретно имели: Stanisław, Anatolij, Ludmiła, Igor..., все неафрыканьцы и много aфрыканьцeв из гаплoгруп A1b1a, A1b1b и их подгрупп. Имя aфрыканьцeв находятся между прочим в стороне Hg. A Project FTDNA.
http://www.familytreedna.com/public/Haplogroup_A/default.aspx?section=yresults
3) Снипы тестированые напр. в пределах WTY частично как будто снипами рода, а частично соединяются (coalescentia) в большие группы, обозначающие более далекиx и наиболее далекиx предков. Такими снипами групп предков: 22 SNP BT, 2 SNP А1b и 21 SNP А1.
Все над А1 снова соединяются с снипами над А0 и создают... Адама.

Цитата
Почему М91 в ВТ, а не в левой ветви?

На эту тему была большая дискуссия на форум Родство.
Игорь хорошо знается с делом.

Цитата
P.S. Присмотрелась, внутри А0 перетасовались группы. Почему-то L1005 cтал снипом А1, хотя у шимп. и чел.последовательности в базе данных в этой позиции одинаковый нуклеотид - А.
Так, это может быть ошибка Крагна.
В index ISOGG SNP 1005: G -> A.


Автор: Odin 8.7.2012, 20:25

Если я правильно понял, А или АТ = L74, то-есть у всех L74+
А вот интересно вдруг у Меланезийцев найдут немного Y* L74-, раз у них есть до 6% "Денисовского" генома.

Автор: Odin 8.7.2012, 20:35

У Perry L74-?

Если да то где можно посмотреть на его гаплотип?

Автор: bugler 8.7.2012, 20:50

Цитата(Odin @ 8.7.2012, 21:25) *
Если я правильно понял, А или АТ = L74, то-есть у всех L74+
А вот интересно вдруг у Меланезийцев найдут немного Y* L74-, раз у них есть до 6% "Денисовского" генома.


Когда пишут о % "денисовского" генома, то это mtДНК. Какая кореляция с Y-ДНК - неизвестно.
Если не найдут L74, то "наша песня хороша, начинай сначала..." laugh.gif .
Уверен, найдут, так как это противоречит парадигме ДНК-генеалогии. Как и то, что человек современной анатомии не вышел из Африки, а пришёл туда примерно 40000 лет назад. Или чуть ранее. И это была гаплогруппа В.

Автор: bugler 8.7.2012, 21:05

Цитата(Odin @ 8.7.2012, 21:35) *
У Perry L74-?

Если да то где можно посмотреть на его гаплотип?


Это, кажется, KIT N64496 ( ссылка выше). И это архаичный гаплотип. Такой же KIT 215865. В 22-маркерном формате:
13 11 12 – 10 11 – 16- 10 9 14 14 8 8 8 9 12 11 12 8 12 12 11 11

Например от базового гаплотипа гаплогруппы Т он отличается на 32 мутации. Примерно 300 тыс.лет до общего предка.

Автор: Odin 8.7.2012, 21:09

Цитата(bugler @ 8.7.2012, 20:50) *
Цитата(Odin @ 8.7.2012, 21:25) *
Если я правильно понял, А или АТ = L74, то-есть у всех L74+
А вот интересно вдруг у Меланезийцев найдут немного Y* L74-, раз у них есть до 6% "Денисовского" генома.


Когда пишут о % "денисовского" генома, то это mtДНК. Какая кореляция с Y-ДНК - неизвестно.
Если не найдут L74, то "наша песня хороша, начинай сначала..." laugh.gif .
Уверен, найдут, так как это противоречит парадигме ДНК-генеалогии. Как и то, что человек современной анатомии не вышел из Африки, а пришёл туда примерно 40000 лет назад. Или чуть ранее. И это была гаплогруппа В.

До 6% Ядерной, не Митогруппу, но раз 6% Ядерной тогда возможно найдут и новую Митогруппу и Y*

Автор: Odin 8.7.2012, 21:28

По проэкту А получается что P97 у всех людей но не очень стабильная(один Араб потерял эту мутацию)

Автор: bugler 8.7.2012, 21:42

Цитата(Odin @ 8.7.2012, 22:09) *
Цитата(bugler @ 8.7.2012, 20:50) *
Цитата(Odin @ 8.7.2012, 21:25) *
Если я правильно понял, А или АТ = L74, то-есть у всех L74+
А вот интересно вдруг у Меланезийцев найдут немного Y* L74-, раз у них есть до 6% "Денисовского" генома.


Когда пишут о % "денисовского" генома, то это mtДНК. Какая кореляция с Y-ДНК - неизвестно.
Если не найдут L74, то "наша песня хороша, начинай сначала..." laugh.gif .
Уверен, найдут, так как это противоречит парадигме ДНК-генеалогии. Как и то, что человек современной анатомии не вышел из Африки, а пришёл туда примерно 40000 лет назад. Или чуть ранее. И это была гаплогруппа В.

До 6% Ядерной, не Митогруппу, но раз 6% Ядерной тогда возможно найдут и новую Митогруппу и Y*


Про ядерную не слышал. unsure.gif Может есть ссылка?

Автор: Odin 8.7.2012, 21:47

Subsequent study of the nuclear genome from this specimen suggests this group shares a common origin with Neanderthals, they ranged from Siberia to Southeast Asia, and they lived among and interbred with the ancestors of some present-day modern humans, with up to 6% of the DNA of Melanesians and Australian Aborigines deriving from Denisovans.[4][5]

4.^ Carl Zimmer (22 December 2010). "Denisovans Were Neanderthals' Cousins, DNA Analysis Reveals". NYTimes.com. Retrieved 22 December 2010.
5.^ a b Callaway, Ewen (September 22, 2011), First Aboriginal genome sequenced, Nature News, DOI:10.1038/news.2011.551

Автор: Odin 8.7.2012, 21:52

Здесь написанно что P97+ (= xBT), я что-то не понял что P97- (= BT)?

http://archiver.rootsweb.ancestry.com/th/read/GENEALOGY-DNA/2012-02/1330242936

Автор: Stanislaw 8.7.2012, 21:58

Цитата(Odin)
Если я правильно понял, А или АТ = L74, то-есть у всех L74+
А вот интересно вдруг у Меланезийцев найдут немного Y* L74-, раз у них есть до 6% "Денисовского" генома.

L74+ во все гаплoгрупах, на стороне А0 и А1
Y человекa дэнисовскoo нет Y_DNA. это девочка примерно 10-рочна



Автор: Odin 8.7.2012, 22:03

Цитата(Stanislaw @ 8.7.2012, 21:58) *
Цитата(Odin)
Если я правильно понял, А или АТ = L74, то-есть у всех L74+
А вот интересно вдруг у Меланезийцев найдут немного Y* L74-, раз у них есть до 6% "Денисовского" генома.

L74+ во все гаплoгрупах, на стороне А0 и А1
Y человекa дэнисовскoo нет Y_DNA. это девочка примерно 10-рочна

Нет там другое написанно что у Меланезийцев до 6% ядерного генома общего с Денисовской девушкой, я об этом.

Автор: Stanislaw 8.7.2012, 22:05

Цитата(Люда @ 7.7.2012, 23:27) *
Бедный Перри, он так и остался один.

Продолжается еще эмбарго на результаты теста WTY Перри and consortes!

Автор: aklyosov 8.7.2012, 23:14

Цитата(Stanislaw @ 8.7.2012, 12:11) *
Цитата
1. Кто конкретно имел именно гаплогруппу А1, имя?
2. Кто конкретно имел гаплогруппу А1b, имя?
3. Если таких не было, на каком основании разделены А1 и А1b?

На что нужное вам имя, если Kahn и WTY их не публикуют?
1) Снипы гаплoгрупы A1 мы имеем все: почти все aфыканьцы и все гаплoгрупы неафрыканьские.
Мы своe им знаем...
21 SNP в гаплoгрупе А1 общее (bottleneck?), прежде чем возникло разветвление (coalescentia) популяции.
2) Гаплогруппу А1b конкретно имели: Stanisław, Anatolij, Ludmiła, Igor...,


Вы или не поняли вопрос, или уклонились от ответа. Суть вопроса понятна из п. 3, на который Вы не ответили. Поэтому - уклонились от ответа.

Хорошо, перефразирую. Мне не нужно имя, мне нужно знать, нашли ли у кого гаплогруппу А1 без снипов Р108 и V221. Иначе говоря, гаплогруппу А1*. Но поскольку Вы обычно уклоняетесь от прямых ответов, то я запросил имя тестированного. Но Вы опять уклонились.

То же самое про А1b*. Есть ли кто-то, у которого есть А1 и/или Р108, но нет снипов ВТ? Только не надо уклоняться, если не знаете, то так и скажите - не знаю.

Уклонились Вы и от последнего вопроса, про М91. Напишите, пожалуйста, эту нуклеотидную последовательность с предковыми нуклеотидами (пусть будет у шимпанзе), ее же в ВТ. Увидите, что она одинакова. Вопрос - на каком тогда основании М91 поместили в ВТ? Это - не снип ВТ.

Если хотите понять вопрос лучше - напишите эту же последовательность нуклеотидов в "африканских" гаплогруппах.

И не надо говорить, что это уже обсуждали. Не знаете - так и скажите.


Автор: Боромир 8.7.2012, 23:17

Цитата(aklyosov @ 7.7.2012, 10:12) *
Цитата(Stanislaw @ 7.7.2012, 6:47) *
Обновленное генеалогическое дерево гагаплoгрупы A и современного человека.


Нормальное дерево, мы с ним давно работаем. Только это дерево не "гаплогруппы А и современного человека", там все мутации получены от современных людей. И там не "гаплогруппа А", а серия гаплогрупп. Остальное все верно:-))

Но есть вопросы:

1. Кто конкретно имел именно гаплогруппу А1, имя?

2. Кто конкретно имел гаплогруппу А1b, имя?

3. Если таких не было, на каком основании разделены А1 и А1b?

...

Первоначально А1 был разделен на А1а и А1b 24 июня 2011 года (см. http://ytree.ftdna.com/taxonomy_editor/log/index.php?name=Draft&node=99813087). Согласно зяблику2 в это время никакиe носители гаплогруппы А анализ WTY не проходили. Значит разделение на А1а и А1b провели на основании анализа ДНК обычных покупателей сервиса ФТДНА. Ключ к кладу А1а - это наличие снипа http://ymap.ftdna.com/cgi-bin/gb2/gbrowse_details/hs_chrY?ref=ChrY;start=20199142;end=20199142;name=M31;class=Sequence;feature_id=46025;db_id=ymap%3Adatabase или отсутствие снипa Р108. Поиск на http://www.familytreedna.com/public/Haplogroup_A/default.aspx?section=ysnp дает 3 положительных на М31 гаплотипа. Это #52093 (37 маркеров), #180250 (111 маркеров) и #16415 (67 маркеров). Все остальные, с понятным исключением клада А0 и Перри - это А1b.

Не уверен, что ответил впопад, поэтому заранее извиняюсь.

На дереве, приведенном паном Станиславом интересен снип L74, который объединяет всё человечество, включая клады А0 и А1. У меня и у пана Станислава (мы оба участники WTY программы) аллель L74 – тимин (Т), т.е. у всех человеков, начиная с "Адама" в локусе L74 тимин (информацию по http://ymap.ftdna.com/cgi-bin/gb2/gbrowse_details/hs_chrY?ref=ChrY;start=15135792;end=15135792;name=L74;class=Sequence;feature_id=44623;db_id=ymap%3Adatabase можно найти на ФТДНА сервере, хотя на http://ytree.ftdna.com/index.php?name=Draft&parent=root он пока отсутствует, как впрочем и "Адам"). У шимпанзе и других приматов аллель L74 - цитозин (С). Получается, что Кран вполне официально укореняет дерево на шимпанзе.

Возникает вопрос почему именно L74 Кран выбрал в качестве снипа определяющего современного человека (Адама в их понятиях ). Видимо это дело случая. Поскольку в среднем геномы человека и шимпанзе сходны на 99%, то, логично предположить, что после сравнения участков Y-хромосомы шимпа и человека, проходящих через WTY–проект (400 000) можно наковырять в первом приближении до 4000 различных снипов отличающих Homo sapiens от шимпа. Собственно репертуар L-снипов уже перевалил за тысячу. Но оставшиеся три тысячи еще ждут своих исследователей.

До сих пор результаты WTY-теста Перри не опубликованы на зяблике2. Как впрочем и результаты еще пяти протестированных "африканцев".

Пан Станислав, кстати, Вы где-то утверждали, что когда-то летом все снипы "африканцев", изъятых с Finch2 должны уже быть опубликованы. Я не ошибаюсь?

Автор: aklyosov 8.7.2012, 23:29

Цитата(Боромир @ 8.7.2012, 15:17) *
Первоначально А1 был разделен на А1а и А1b 24 июня 2011 года. Согласно зяблику2 в это время никакиe носители гаплогруппы А анализ WTY не проходили. Значит разделение на А1а и А1b провели на основании анализа ДНК обычных покупателей сервиса ФТДНА.


Не обязательно. Эти "покупатели" неизвестны, и в проекте "Гаплогруппа А" их тоже нет.

Не исключено, что разделение проведено с потолка, и гаплогруппа А1b вообще мифическая. Это - гаплогруппа А1, она же альфа-гаплогруппа.

Дальше Вы поясняете по снип М31, но про него вопроса вообще не было. С гаплогруппой A1a-М31 вопросов нет.

Вопрос в том, на каком основании Р108 и V221 вынесли в отдельную гаплогруппу (A1b), следов которой нет ни в одном проекте, и нет в WTY. Я потому про имена и спросил.


Автор: Igor1961 9.7.2012, 1:43

Цитата(Stanislaw @ 9.7.2012, 3:58) *
Цитата(Odin)
Если я правильно понял, А или АТ = L74, то-есть у всех L74+
А вот интересно вдруг у Меланезийцев найдут немного Y* L74-, раз у них есть до 6% "Денисовского" генома.

L74+ во все гаплoгрупах, на стороне А0 и А1
Y человекa дэнисовскoo нет Y_DNA. это девочка примерно 10-рочна

А что, мужчин у них не было? Одни девочки? smile.gif

Лично я не вижу ничего фантастического, что когда-нибудь выскочит Y-хромосомная линия, идущая от тех людей. Меланезийский Перри, так сказать.

Автор: Igor1961 9.7.2012, 4:36

Цитата(aklyosov @ 9.7.2012, 5:29) *
Не исключено, что разделение проведено с потолка, и гаплогруппа А1b вообще мифическая. Это - гаплогруппа А1, она же альфа-гаплогруппа.

Дальше Вы поясняете по снип М31, но про него вопроса вообще не было. С гаплогруппой A1a-М31 вопросов нет.

Вопрос в том, на каком основании Р108 и V221 вынесли в отдельную гаплогруппу (A1b), следов которой нет ни в одном проекте, и нет в WTY. Я потому про имена и спросил.

Вот данные с гаплогруппного проекта. Поскольку системные администраторы FTDNA явно не поспевают за работой своего собственного сотрудника (Томаса Крана), плюсы и минусы на страничке снипов безнадежно перепутаны. Потому даю оригинальные нуклеотиды.

P108 = C (шимпанзе - С)
N71150 Boon A0
N38376 Jones A0
N14468 Dorsey A0
25210 Morten A0 (predicted)
180250 Phillips A1a (М31+)
16415 Wright A1a (М31+)
Р108 = Т
181787 Gage A1b1a (V50+)
200747 Saudi Arabia A1b1b2b (M13+)
176787 Panossian A1b1b2b (M13+)
151201 Boyd A1b1b2b (M13+)
121019 Boyd A1b1b2b (M13+)

Статистика по http://ytree.ftdna.com/
count_derived: 297
count_tested: 307
То есть, помимо тех шестерых участников проекта, еще у четырех человек нашли предковый нуклеотид С.

V221= G (шимпанзе - G)
N64496 Perry A0
N38376 Jones A0
180250 Phillips A1a (M31+)
V221 = T
181787 Gage A1b1a (V50+)

Статистика по http://ytree.ftdna.com/
count_derived: 107
count_tested: 114
Имена еще четверых, как и в случае Р108, неизвестны.

По этим данным видно, что снипы Р108 и V221 находятся на своем месте, разделяя А1а и A1b.

Если в базах данных есть "чистые" А1*(хА1а,хA1b), то они могут оказаться в этой четверке неизвестных. Впрочем, вероятность весьма мала.

Автор: aklyosov 9.7.2012, 5:17

Цитата(Igor1961 @ 8.7.2012, 20:36) *
По этим данным видно, что снипы Р108 и V221 находятся на своем месте, разделяя А1а и A1b.


Я этого не вижу.

Мой вопрос был не о разделении А1а и A1b, а о наличии A1b вообще. Я не вижу ни одного человека с гаплогруппой A1b*. Поэтому за разделение А1а с якобы A1b можно легко принять разделение A1a и А1.

Давайте из Вашего списка уберем избыточную информацию, кто там чего путает, уберем А0 и уберем А1а, с которой вообще вопросов нет. Ее имеют много людей, и сомнений там нет.

Итак:

Цитата(Igor1961 @ 8.7.2012, 20:36) *
Цитата(aklyosov @ 9.7.2012, 5:29) *
Не исключено, что разделение проведено с потолка, и гаплогруппа А1b вообще мифическая. Это - гаплогруппа А1, она же альфа-гаплогруппа.

Дальше Вы поясняете по снип М31, но про него вопроса вообще не было. С гаплогруппой A1a-М31 вопросов нет.

Вопрос в том, на каком основании Р108 и V221 вынесли в отдельную гаплогруппу (A1b), следов которой нет ни в одном проекте, и нет в WTY. Я потому про имена и спросил.


P108 = C (шимпанзе - С)
Р108 = Т
То есть, помимо тех шестерых участников проекта, еще у четырех человек нашли предковый нуклеотид С.

V221= G (шимпанзе - G)
V221 = T

Имена еще четверых, как и в случае Р108, неизвестны.

По этим данным видно, что снипы Р108 и V221 находятся на своем месте, разделяя А1а и A1b.


Итак, когда из списка убрали А0, А1а и субклады А1b, то никого не осталось. Нет никого со снипами Р108 и V221, не считая подчиненных субкладов, которые могут в той же степени оказаться подчиненными А1, в который входят P108 и V221.

В этом и был мой вопрос - зачем отделять Р108 и V221 от гаплогруппы А1? Они замечательно смотрятся всем блоком в гаплогруппе А1. И тогда снипы Р108 и V221 (как и многие другие) разделяют А1 и А1а. Чем плохо? Зачем нужна A1b, тем более, что таких людей, похоже, нет. Похоже, что это - фантомная гаплогруппа-субклад.


Автор: Igor1961 9.7.2012, 6:01

Цитата(aklyosov @ 9.7.2012, 11:17) *
Мой вопрос был не о разделении А1а и A1b, а о наличии A1b вообще. Я не вижу ни одного человека с гаплогруппой A1b*. Поэтому за разделение А1а с якобы A1b можно легко принять разделение A1a и А1.
...Похоже, что это - фантомная гаплогруппа-субклад.

А как в таком случае отобразить в нотации, что Р108=Т и V221=T у A-V50, А-М13 и всех гаплогрупп, производных от ВТ? То есть, узел, из которого они расходятся, находится чуть "ниже по течению", чем развилка А1 - А1а. Я пока не могу представить других вариантов, что сочетались бы с предковыми Р108=С и V221=G у носителей А-М31. Потому и вводятся индексы "а" и "b", чтобы отобразить такую топологию.

То, что нет ни одного человека с гаплогруппой A1b*, еще ни о чем не говорит. В коммерческих базах данных нет ни одного подтвержденного носителя IJ*, I*, J*, Q*, Q1*, Q1a*, R1b*, что отнюдь не делает эти гаплогруппы фантомными. В данном случае под буквенными обозначениями закодированы определенные комбинации снипов, что возможны по текущему состоянию дел в SNP-филогении, не более того.

Автор: Боромир 9.7.2012, 6:03

Анатолий Алексеевич, мой пост в некотором смысле повторяет пост ИР, но может поможет.

Цитата(aklyosov @ 8.7.2012, 16:29) *
Вопрос в том, на каком основании Р108 и V221 вынесли в отдельную гаплогруппу (A1b), следов которой нет ни в одном проекте, и нет в WTY. Я потому про имена и спросил.

Я ведь специально привел ссылку в своём предыдущем сообщении на, видимо, первоначальное время разделения кладов A1a и A1b. Повторю ещё раз: (см.http://ytree.ftdna.com/taxonomy_editor/log/index.php?name=Draft&node=99813087). По ссылке видно, что со снипом P108 происходили кульбиты, которые в виде, теперь уж некорректно обозначеных снипов P108, остались на некоторых проектах и сбивают с толку. Такая же ситуация, кстати, видимо, была и со снипом SRY10831.2. Где-то видел гаплотип, который одновременно был обозначен SRY10831.2- и SRY10831.2+. ohmy.gifsad.gif

Теперь к конкретным именам с требуемыми снипами клада A1b. Начнём с меня. В декабре прошлого года, во время очередного кульбита мои снип Р108 и индель М91, которые первоначально были определены как отрицательные, были переименованы в положительные (понятно, что значения аллелей не поменялись). Снип V221 у меня не определялся (V-серия Круциани не была известна, когда я проходил WTY-тест), зато начиная с Леслы, показано, что все R1a1, прошедшие WTY несут положительный V221, как и V168 (определяет принадлежность к А1).

WTY тест показал у меня отрицательный М31 (отрицателен у всех R1a1 участников проекта), что исключает принадлежность к кладу А1а. В предыдущем моём сообщении приведены 3 участника с положительным М31, причем у двоих из них М31+,Р108+. Это, надо полагать, последствие неисправленного кульбита с Р108. В противном случае придется нехорошо подумать о Томасе Кране, но к нему претензий до сих пор не было, а вот неоткорректированные после кульбитов маркеры, как было показано, встречаются. Кого в этом обвинять - вопрос не относящийся к дискуссии.

У А-М31 #180250 с проекта http://www.familytreedna.com/public/Haplogroup_A/default.aspx?section=ysnp положителен V168, что помещает его в один с нами клад более высокого порядка - это клад А1. Так, что все верно: А1 расщепляется на А1а и A1b и мы в кладе A1b.

Автор: Odin 9.7.2012, 8:07

Уважаемый А.Клёсов,
Может вот это?

181787 Nazareth Gage (1848-1912)
M42- (= xBT), SRY10831.1- (= xBT), V221+(=A1b)

Автор: aklyosov 9.7.2012, 12:23

Цитата(Боромир @ 8.7.2012, 22:03) *
Цитата(aklyosov @ 8.7.2012, 16:29) *
Вопрос в том, на каком основании Р108 и V221 вынесли в отдельную гаплогруппу (A1b), следов которой нет ни в одном проекте, и нет в WTY. Я потому про имена и спросил.

...По ссылке видно, что со снипом P108 происходили кульбиты

...Теперь к конкретным именам с требуемыми снипами клада A1b. Начнём с меня. В декабре прошлого года, во время очередного кульбита мои снип Р108 и индель М91, которые первоначально были определены как отрицательные, были переименованы в положительные (понятно, что значения аллелей не поменялись). Снип V221 у меня не определялся...
...показано, что все R1a1, прошедшие WTY несут положительный V221, как и V168 (определяет принадлежность к А1).

WTY тест показал у меня отрицательный М31 (отрицателен у всех R1a1 участников проекта), что исключает принадлежность к кладу А1а...

В предыдущем моём сообщении приведены 3 участника с положительным М31, причем у двоих из них М31+,Р108+. Это, надо полагать, последствие неисправленного кульбита с Р108. В противном случае придется нехорошо подумать о Томасе Кране, но к нему претензий до сих пор не было...

...У А-М31 #180250 ... положителен V168, что помещает его в один с нами клад более высокого порядка - это клад А1.

Так, что все верно: А1 расщепляется на А1а и A1b и мы в кладе A1b.


Уважаемый Боромир,

Возможно, это "кульбиты" с переименованием в классификации причина того, что я никак не пойму, зачем нужен субклад А1b. Всё, что Вы привели, можно описать центральной гаплогруппой А1, от которой отходят А1а и ВТ.

Тогда вот это "...показано, что все R1a1, прошедшие WTY несут положительный V221, как и V168 (определяет принадлежность к А1)" можно уже не приводить, это уже очевидная и избыточная информация. A1b там нет.

То же самое и вот это: "Начнём с меня. В декабре прошлого года, во время очередного кульбита мои снип Р108 и индель М91, которые первоначально были определены как отрицательные, были переименованы в положительные (понятно, что значения аллелей не поменялись). Снип V221 у меня не определялся..." А1b и здесь нет.

И это избыточная и очевидная информация: "WTY тест показал у меня отрицательный М31 (отрицателен у всех R1a1 участников проекта), что исключает принадлежность к кладу А1а..." A1b здесь тоже нет.

И это: "...У А-М31 #180250 ... положителен V168, что помещает его в один с нами клад более высокого порядка - это клад А1". Это вообще к A1b не имеет отношения.

Поэтому последняя фраза "Так, что все верно: А1 расщепляется на А1а и A1b и мы в кладе A1b." вызывает недоумение. Все, что Вы описали выше, делает ее фразой: Так, что все верно: от А1 отщепляется А1а и мы в кладе A1.

Разве не так?

Автор: aklyosov 9.7.2012, 12:29

Что же касается - "...Начнём с меня. В декабре прошлого года, во время очередного кульбита мои снип Р108 и индель М91, которые первоначально были определены как отрицательные, были переименованы в положительные (понятно, что значения аллелей не поменялись)", то можно не обращать внимание на "кульбиты", и просто посмотреть на ту серию нуклеотидов, которые определяют М91 у Вас, и на исходную, предковую последовательность (например, в шимпанзе).

Попробуйте здесь написать в форме:

Шимпанзе......

Боромир ......

И сразу увидите, есть у Вас этот снип или нет. Чтобы он был, у шимпанзе должен быть один, у Вас - другой. Вы говорите, что по данным Крана у Вас этот снип есть, то есть у Вас якобы другое, чем у шимпанзе.

Ну как, написали?

Помочь?

Автор: Боромир 9.7.2012, 16:16

OK. На М91 Вы меня подловили: и у шимпанзе, и у Боромира в локусе инделя М91 аллель 9Т (insertion). Если укоренять по шимпанзе (а это явно следует из снипа L74 – общего для всех человеков согласно приведенному в первом сообщении этой темы дереву Станислова, согласованному с Краном), то М91 надо перекидывать в клад А0, у которого в локусе М91 аллель 8Т (deletion) (проверял по Jones - A0a2 и Dorsey - A0b, у которых там 8Т). С другой стороны, у турка А-М13 (#176787), который по Станиславу/Крану в нашем "A1b" кладе smile.gif в М91 тоже аллель 8Т. Чертовщина. Нужно больше информации, но она закрыта, а та что доступна запутана кульбитами и не понятно чему верить. Вот такой расклад на сегодня.

Получается что на принципиальный вопрос о A1b – to be or not to be - ответить не могу, надо ещё подумать. Загоревал sad.gif и ушел в огород думать.

Автор: Stanislaw 9.7.2012, 17:38

Цитата(Боромир @ 9.7.2012, 17:16) *
С другой стороны, у турка А-М13 (#176787), который по Станиславу/Крану в нашем "A1b" кладе smile.gif в М91 тоже аллель 8Т. Чертовщина. Нужно больше информации, но она закрыта, а та что доступна запутана кульбитами и не понятно чему верить. Вот такой расклад на сегодня.

У турка GRC10039758 #176787 нет тестирования снипа M91!

Автор: Боромир 9.7.2012, 18:04

Цитата(Stanislaw @ 9.7.2012, 10:38) *
Цитата(Боромир @ 9.7.2012, 17:16) *
С другой стороны, у турка А-М13 (#176787), который по Станиславу/Крану в нашем "A1b" кладе smile.gif в М91 тоже аллель 8Т. Чертовщина. Нужно больше информации, но она закрыта, а та что доступна запутана кульбитами и не понятно чему верить. Вот такой расклад на сегодня.

У турка GRC10039758 #176787 нет тестирования снипа M91!

Ага! А вот эту запись из списка маркеров гаплотипа #176787 куда позволите деть? (В экселевском файле запись идет в одну строку)

GRC10039758 M91 del- 1 thomas 2011-01-04 00:17:47 GRC10039758_WTY_J24_sL316_R|2865080,GRC10039758_365_B09_M91_R|2178392,GRC1003975
8_WTY_F19_sM91M120M121_R|2864456,GRC10039758_WTY_F19_sM91M120M121_F|2864643,GRC10
039758_WTY_J24_sL316_F|2865342,GRC10039

Значение аллеля выделено мною.

Пан Станислав, список маркеров #176787 Вы можете самостоятельно сгрузить с Finch2 и убедится, что ошибки нет.

Автор: Stanislaw 9.7.2012, 18:24

Цитата(Боромир @ 9.7.2012, 18:04) *
Цитата(Stanislaw @ 9.7.2012, 10:38) *
Цитата(Боромир @ 9.7.2012, 17:16) *
С другой стороны, у турка А-М13 (#176787), который по Станиславу/Крану в нашем "A1b" кладе smile.gif в М91 тоже аллель 8Т. Чертовщина. Нужно больше информации, но она закрыта, а та что доступна запутана кульбитами и не понятно чему верить. Вот такой расклад на сегодня.

У турка GRC10039758 #176787 нет тестирования снипа M91!

Ага! А вот эту запись из списка маркеров гаплотипа #176787 куда позволите деть? (В экселевском файле запись идет в одну строку)

GRC10039758 M91 del- 1 thomas 2011-01-04 00:17:47 GRC10039758_WTY_J24_sL316_R|2865080,GRC10039758_365_B09_M91_R|2178392,GRC1003975
8_WTY_F19_sM91M120M121_R|2864456,GRC10039758_WTY_F19_sM91M120M121_F|2864643,GRC1
0
039758_WTY_J24_sL316_F|2865342,GRC10039
Значение аллеля выделено мною.

Пан Станислав, список маркеров #176787 Вы можете самостоятельно сгрузить с Finch2 и убедится, что ошибки нет.

Так, вы прав!
М91, я не знаю почему, не расположен в порядке очереди букв и цифр, но только в конце, по "V" букве (среди дополнительных тестов?)




Автор: Igor1961 9.7.2012, 19:49

Цитата(Боромир @ 9.7.2012, 22:16) *
Чертовщина. Нужно больше информации, но она закрыта, а та что доступна запутана кульбитами и не понятно чему верить. Вот такой расклад на сегодня.

А Вы не ловитесь на кульбиты. Как хороший защитник, смотрите на мяч, а не на ноги всяких там Криштиану Роналду от ДНК-генеалогии. Под мячом имею в виду сам нуклеотид.

Напрмер, если на зяблике против фамилии Джонс стоит M91 del, а на проекте он же помечен как M91+, то, значит, те, кто записан М91-, имеют инсерцию, т. е. 9Т. При этом совершенно не должно волновать, что там думает Томас Кран (а думает он обычно по делу), Бонни Шрак или анонимный сисадмин, что расставляет по чьей-либо команде плюсы и минусы в графе снипов. Берете программу dnapars или dnapenny из пакета PHYLIP, вводите в нее последовательности нуклеотитов, и в течение 1-2 секунд получаете оптимизированную расстановку снипов. Зная положение корня из данных по шимпанзе, не составит большого труда самому вычислить, какой нуклеотид предковый, какой производный, а также выявить нестабильные снипы.

К слову, к таковым может относиться М91. На проекте М91- (=9Т) отмечен для саудовского араба M7223 и финского шведа 208466, 67-маркерные гаплотипы которых однозначно попадают в ветви A1b1b2 и А1а, соответственно. Их ближайшие соседи имеют ожидаемые М91+ (8Т).

Автор: Stanislaw 9.7.2012, 19:57

http://www.rodstvo.ru/forum/index.php?showtopic=3158&st=0
Посмотрите над дерево.
Под "Rооt - Adam" я рядом L74 устроил второй снип Адама: М91=8Т.

Автор: Igor1961 9.7.2012, 20:14

Цитата(Stanislaw @ 10.7.2012, 1:57) *
Под "Rооt - Adam" я рядом L74 устроил второй снип Адама: М91=8Т.

Тогда уточните, что это М91.1 с предковым значением 9Т (шимпанзе) и производным 8Т (А0/А1).
Мутация, что у носителей ВТ переводит 8Т (А1) в совпадающий с шимпанзе фрагмент 9Т, по правилам, должна записываться как М91.2.

По определению, нуклеотиды в таких мутациях могут принмать только 2 значения, откуда другое название снипа - binary polymorphism. Если мы видим 3 или более варианта, то, значит, в этом локусе имели место 2 или более мутации, никак не связанные друг с другом. По правилам, их пишут с добавлением индекса после точки.

Автор: Igor1961 9.7.2012, 20:50

Цитата(aklyosov @ 9.7.2012, 18:23) *
Поэтому последняя фраза "Так, что все верно: А1 расщепляется на А1а и A1b и мы в кладе A1b." вызывает недоумение. Все, что Вы описали выше, делает ее фразой: Так, что все верно: от А1 отщепляется А1а и мы в кладе A1.

Разве не так?

Не так, потому что это противоречит алгоритму, по которому составляется нотация ISOGG и YCC. Если из гаплогруппы А1 отщепилась ветвь А1а, охарактеризованная хотя бы одним собственным снипом, то после развилки А1 без индекса может обозначать только т.н. парагруппу, т.е. гаплотипы, для которых не найдены снипы помимо тех, что характеризуют А1. Если нисходящие снипы имеются, то по определению к А1 добавляется буквенный индекс. В нашем случае такие снипы есть (Р108 и V221), а потому второй зуб вилки получает обозначение A1b.

Теоретически, из того же узла должна также выходить парагруппа А1*. Будут там "живые" гаплотипы или нет, зависит от конкретной ситуации. К примеру, еще 3 года назад вся гаплогруппа R1a1 состояла из парагруппы R1a1*, куда входили все известные гаплотипы, и 6-ти пустых субкладов R1a1a ... R1a1f, а сейчас мы днем с огнем ищем хотя бы один гаплотип, что не попадал бы ни в один из уже охарактеризованных субкладов, нисходящих от М417.

Впрочем, разделение на А1а и A1b никак не противоречит понятию альфа-гаплогруппы с параллельно расходящимися ветвями. Просто узел становится там не тугим, а немного "ослабленным" за счет перемычки из 2-х снипов. Все остальное работает.

Автор: Stanislaw 9.7.2012, 22:26

Цитата(Igor1961 @ 9.7.2012, 21:14) *
Цитата(Stanislaw @ 10.7.2012, 1:57) *
Под "Rооt - Adam" я рядом L74 устроил второй снип Адама: М91=8Т.

Тогда уточните, что это М91.1 с предковым значением 9Т (шимпанзе) и производным 8Т (А0/А1).
Мутация, что у носителей ВТ переводит 8Т (А1) в совпадающий с шимпанзе фрагмент 9Т, по правилам, должна записываться как М91.2.

Я написал коротко, какое состояние Адам имел и передал ветвям А0 и А1.
Добавлять обозначений .1 или .2 вызвало бы может быть удивение, откуда это походит.

Правду говоря, не известно, ли совершилась дэлецья у "Адама" ли инсэрцья у шимпанзе.


Автор: Odin 9.7.2012, 23:46

Цитата(Stanislaw @ 9.7.2012, 22:26) *
Правду говоря, не известно, ли совершилась дэлецья у "Адама" ли инсэрцья у шимпанзе.

Надо и Горилу проверить.

Автор: aklyosov 10.7.2012, 12:34

Цитата(Боромир @ 9.7.2012, 8:16) *
и у шимпанзе, и у Боромира в локусе инделя М91 аллель 9Т (insertion)...
то М91 надо перекидывать в клад А0, у которого в локусе М91 аллель 8Т (deletion) (проверял по Jones - A0a2 и Dorsey - A0b, у которых там 8Т). С другой стороны, у турка А-М13 (#176787), который по Станиславу/Крану в нашем "A1b" кладе smile.gif в М91 тоже аллель 8Т. Чертовщина.


Никакой чертовщины нет, все довольно просто. Смотрите:

Шимпанзе (предковая) - 9Т
Боромир (ВТ-->R1a) - 9T
А-M13 - 8T

Это означает, что предковая аллель прошла без изменений от шимпанзе в А1 и далее в ВТ, и снипа М91 у неафриканцев нет. Зато он произошел при переходе от А1 к африканцам и прочим А1а (в данном случае у турка), у кого этот снип есть.

В свою очередь это означает, что не нужно было переносить М91, он был на месте. Далее это означает, что мы не произошли от африканцев, во всяком случае от тех, у кого есть этот снип. У нас его нет.

Так получается по этим и другим данным. Если есть данные новые, рассмотрим.

Цитата(Боромир @ 9.7.2012, 8:16) *
Получается что на принципиальный вопрос о A1b – to be or not to be - ответить не могу, надо ещё подумать.


Да, как видите, А1b и здесь пока нет, не просматривается.

Естественно, не просматривается - не значит, что ее нет. Это значит, что для данных примеров без нее можно обойтись. Естественно, можно вводить хоть гирлянды умозрительных снипов, весь вопрос в том, какие исторические положения на этом строятся. Я прекрасно понимаю, что введение A1b не нарушает концепцию альфа-гаплогруппы и расхождения генеалогии на фариканцев и неафриканцев, но система должна быть минимизирована по имебщимся данным.

Аналогия с I*, например, которого тоже не нашли, плохо работает. Это - скорее аналогия с введением I** и I***, которых тоже не нашли. Нужно ли их вводить?


Автор: Люда 10.7.2012, 16:42

aklyosov

Цитата
Это означает, что предковая аллель прошла без изменений от шимпанзе в А1 и далее в ВТ, и снипа М91 у неафриканцев нет. Зато он произошел при переходе от А1 к африканцам и прочим А1а (в данном случае у турка), у кого этот снип есть.

Если считать М91 снипом, то делеция 1Т должна была произойти у общего предка человека, потому что и у А0, и у А1а и A1b1a - 8T (в противном случае, у каждой из ветвей эта мутация должна была произойти независимо друг от друга). После разделения на А1b1 и ВТ, у ВТ должна была пройти возвратная мутация.
Возможно, вообще этот маркер нестабилен.
Кроме того, когда мы сравниваем с шимпанзе, все-таки это У хромосома одного самца. Для более точного определения предкового нуклеотида нужна статистика.

Stanislaw
Цитата
Под "Rооt - Adam" я рядом L74 устроил второй снип Адама

Обозначение неудачное. Правильно Вам Игорь написал:
Цитата
Мутация, что у носителей ВТ переводит 8Т (А1) в совпадающий с шимпанзе фрагмент 9Т, по правилам, должна записываться как М91.2. М91=8Т.


Odin
Цитата
Надо и Горилу проверить.

У гориллы 100 в фрагмент с этим снипом гомологию не нашел. Может быть надо взять больший фрагмент для поиска.
У макаки 7Т в гомологичном фрагменте на У-хромосоме.
У шимп. кстати рядом с 9Т лишняя G по сравнению с ВТ (наверно и с остальным человечеством?)

Автор: Stanislaw 10.7.2012, 18:33

Цитата(Люда @ 10.7.2012, 17:42) *
Stanislaw
Цитата
Под "Rооt - Adam" я рядом L74 устроил второй снип Адама

Обозначение неудачное. Правильно Вам Игорь написал:
Цитата
Мутация, что у носителей ВТ переводит 8Т (А1) в совпадающий с шимпанзе фрагмент 9Т, по правилам, должна записываться как М91.2. М91=8Т.

Я не имею власти создавать новые номера для снипов!
Знаком =8Т я констатирую действительное состояние, безотносительно чем прежнего.
Никто из нас не знает, ли 8Т суть родом из времен перед разойтением линии чeловека и шимапнсe и есть первоначальное состояние,
ли возник только по разойтению этих линий, вследствие дэлецйи 9Т->8Т.


Автор: Stanislaw 10.7.2012, 20:01

Цитата(aklyosov @ 10.7.2012, 12:34) *
Цитата(Боромир @ 9.7.2012, 8:16) *
и у шимпанзе, и у Боромира в локусе инделя М91 аллель 9Т (insertion)...
то М91 надо перекидывать в клад А0, у которого в локусе М91 аллель 8Т (deletion) (проверял по Jones - A0a2 и Dorsey - A0b, у которых там 8Т). С другой стороны, у турка А-М13 (#176787), который по Станиславу/Крану в нашем "A1b" кладе smile.gif в М91 тоже аллель 8Т. Чертовщина.


Никакой чертовщины нет, все довольно просто. Смотрите:
Шимпанзе (предковая) - 9Т
Боромир (ВТ-->R1a) - 9T
А-M13 - 8T
Это означает, что предковая аллель прошла без изменений от шимпанзе в А1 и далее в ВТ, и снипа М91 у неафриканцев нет. Зато он произошел при переходе от А1 к африканцам и прочим А1а (в данном случае у турка), у кого этот снип есть.
В свою очередь это означает, что не нужно было переносить М91, он был на месте. Далее это означает, что мы не произошли от африканцев, во всяком случае от тех, у кого есть этот снип. У нас его нет.

Было пять WTY в гаплoгрупах A1, не-БТ (слева от БТ).
В А1а тестировал Cruciani.
В А1b1а WTY: М114, P28 и P262
В а1b1b WTY: М13.

Bo всеx тестах: М91 del-, то есть 9Т->8Т.
Итак в А1=8T аналогично как в А0.
Это так снип Адама !



Автор: aklyosov 10.7.2012, 22:33

Цитата(Люда @ 10.7.2012, 8:42) *
aklyosov
Цитата
Это означает, что предковая аллель прошла без изменений от шимпанзе в А1 и далее в ВТ, и снипа М91 у неафриканцев нет. Зато он произошел при переходе от А1 к африканцам и прочим А1а (в данном случае у турка), у кого этот снип есть.

Если считать М91 снипом, то делеция 1Т должна была произойти у общего предка человека, потому что и у А0, и у А1а и A1b1a - 8T (в противном случае, у каждой из ветвей эта мутация должна была произойти независимо друг от друга).


Мы говорим об одном и том же.

То, что Вы написали, означает, что мутация от предкового 9Т до 8Т произошла у африканских линий (А0, А1а, A1b1a). В А1/A1b (то есть альфа-гаплогруппе) этой мутации нет, как нет ее у уважаемого Боромира (у него, как и у шимпанзе, 9Т).

Иначе говоря, схема сохраняется. От шимпанзе к А1/A1b мутации не было, как ее не было и при дальнейшем пути к Боромиру. Но при переходе к африканским линиям эта мутация возникла, поэтому это у них есть М91+.

Потому я и говорю, что не нужно было ее трогать, она раньше и была у "гаплогруппы А". А в ВТ ее не было. Так оно и есть, у BT М91- (то есть осталась предковая последовательность), а у африканцев М91+ (9Т-->8T).


Автор: aklyosov 10.7.2012, 22:43

Цитата(Stanislaw @ 10.7.2012, 12:01) *
Было пять WTY в гаплoгрупах A1, не-БТ (слева от БТ).
В А1а тестировал Cruciani.
В А1b1а WTY: М114, P28 и P262
В а1b1b WTY: М13.

[b] Bo всеx тестах: М91 del-, то есть 9Т->8Т.
Итак в А1=8T аналогично как в А0.


Вы все никак не поймете, что А1 является началом двух совершенно разных, расходящихся (или параллельных, как кому удобнее называть) линий человечества - африканской и неафриканской. Поэтому говорить (или писать) "в гаплогруппах А1" лишено смысла. Это - начало ВСЕХ гаплогрупп мира, кроме А0.

От А1 расходятся два направления генеалогии Y-хромосомы: африканские (A1a и нисходящие от A1b, как A1b1a, A1b1b, и так далее, их еще много найдут), и неафриканские, уходящие к BT. У первых - 8Т, то есть снип М91+. У вторых (неафриканских) 9Т, то есть нет снипа М91, или М91-.

Еще одна африканская, группа А0, тоже имеет М91+.

Все очень просто. Читайте статью в Adv. Anthropology, там есть диаграмма расхождения линий. Она все поясняет.

Автор: Stanislaw 11.7.2012, 9:32

Цитата(aklyosov @ 10.7.2012, 23:43) *
Цитата(Stanislaw @ 10.7.2012, 12:01) *
Было пять WTY в гаплoгрупах A1, не-БТ (слева от БТ).
В А1а тестировал Cruciani.
В А1b1а WTY: М114, P28 и P262
В а1b1b WTY: М13.
Bo всеx тестах: М91 del-, то есть 9Т->8Т.
Итак в А1=8T аналогично как в А0.

Вы все никак не поймете, что А1 является началом двух совершенно разных, расходящихся (или параллельных, как кому удобнее называть) линий человечества - африканской и неафриканской. Поэтому говорить (или писать) "в гаплогруппах А1" лишено смысла. Это - начало ВСЕХ гаплогрупп мира, кроме А0.
От А1 расходятся два направления генеалогии Y-хромосомы: африканские (A1a и нисходящие от A1b, как A1b1a, A1b1b, и так далее, их еще много найдут), и неафриканские, уходящие к BT. У первых - 8Т, то есть снип М91+. У вторых (неафриканских) 9Т, то есть нет снипа М91, или М91-.
Еще одна африканская, группа А0, тоже имеет М91+.
Все очень просто...

Всьё - для моего устроиства мозга - очень непросто!

Если во всех генеалогических линиях А1а, А1b1а и А1b1b М91=8Т, то есть, что и в отцовском А1 было только М91=8Т - так же как есть в А0, и следовательно у Адама.

Ничто так не позволяет, чтобы открытый только в генеалогической линии А1b2=BТ snip M91=9T можно было приписать отцовскому А1. Это ее собственная мутация.

Ничто нас не уполномочивает к уйтию от правила ”бритвы Оckham'a”.


Автор: aklyosov 11.7.2012, 12:57

Цитата(Stanislaw @ 11.7.2012, 1:32) *
Всьё - для моего устроиства мозга - очень непросто!


Понимаю. Это я давно заметил.

Но когда непросто - не нужно делать вид, что имеющаяся классификация верна.

Цитата(Stanislaw @ 11.7.2012, 1:32) *
Если во всех генеалогических линиях А1а, А1b1а и А1b1b М91=8Т, то есть, что и в отцовском А1 было только М91=8Т - так же как есть в А0, и следовательно у Адама.


Это принципиально неверно. Это все равно, что сказать, что если у потомков есть мутации, то они обязательно есть и у предка. По этой же "логике" 8Т должно быть и у R1a. А там - 9T.

Вам мешает прямо-таки религиозная вера в то, что если так назвали линии, именно такими индексами, то так оно и есть. А там могут быть промежуточные, которые еще не обнаружили.

На самом деле самое важное обстоятельство вовсе не там. Пусть в А1 будет 8Т, пусть те же 8Т будут в африканских линиях. Но в неафриканских линиях там 9Т. Иначе говоря, африканская снип-мутация НЕ унаследована в неафриканских линиях. Мы - не потоки африканцев.

Важно, что дискуссия была о том, что предковая мутация (она же в шимпанзе) 9Т, у африканцев она 8Т (см. Ваши данные выше), в ВТ она 9Т, но почему-то снип М91 приписан не к африканским линиям, а к ВТ. Вот ведь о чем была дискуссия, а Вы от этого почему-то уходите.

Цитата(Stanislaw @ 11.7.2012, 1:32) *
Ничто нас не уполномочивает к уйтию от правила ”бритвы Оckham'a”.


Именно так.

На самом деле все Ваши комментарии стоят на песке. У нас все равно нет никого с гаплогруппой А1, ни в WTY, ни в проекте гаплогруппы А. Какая там на самом деле снип-мутация мы все равно не знаем. В какой исторический момент эта мутация произошла - мы не знаем. Стабильна ли она - мы не знаем, но не надо придумывать нестабильность, когда можно объяснить стабильностью. Все рассуждения на данный счет - это результаты ряда допущений. Но суть одна - неафриканцы не произошли от африканцев.

Опять, М91 относится к африканцам, а не к неафриканцам. Вот Вам и правило Оккама. Вы на словах якобы за это правило, а сами начинаете метаться и придумывать комбинации, как это объяснить.


Автор: Stanislaw 11.7.2012, 20:28

Цитата(aklyosov)
Цитата(Stanislaw)
Всьё - для моего устроиства мозга - очень непросто!
Понимаю. Это я давно заметил.
Tак, я именно цитирую только ваши слова. Сам свой или чужой мозг я так не оскорблял бы...
Но давайте - подарим это себя, забудем об этом!
..............................
Давайте пройдем к теме
(потому что ничто нет более плохого, чем спорить о дискуссии и ее участниках. Я этого обычно не делаю!)

Мутации SNP в отдельныx нукледотыдах (в парax оснований) возникают в среднем однажды на миллиард лет и имеют стабильный характер. Поэтому в генетической генеалогии обязывает принцип, что если какая-то мутация констатирована у двox или более братьев, это обозначает, что она походит от отца.
В противном случае потребность несколько параллельныx и такиx же мутацйи.
И в этом сидит конфликт с принципом Оккама.


Автор: Шоломич 12.7.2012, 17:46

Цитата(aklyosov @ 10.7.2012, 13:34) *
Шимпанзе (предковая) - 9Т
Боромир (ВТ-->R1a) - 9T
А-M13 - 8T

Итог: африканская гаплогруппа А1а (снип М91) находится дальше, по отношению к нам, чем шимпанзе. Хотя этот вид от нас настолько далёк, в биологическом плане, что даже не скрещивается с нами. А вот представители человеческой расы, которые хоть и дают потомство, при скрещивании с нами, почему-то от нас дальше, чем обезьяны.
Эволюция - одним словом.
А пипл хавает...
biggrin.gif

Автор: Stanislaw 12.7.2012, 18:09

Цитата(Шоломич @ 12.7.2012, 17:46) *
Цитата(aklyosov @ 10.7.2012, 13:34) *
Шимпанзе (предковая) - 9Т
Боромир (ВТ-->R1a) - 9T
А-M13 - 8T

Итог: африканская гаплогруппа А1а (снип М91) находится дальше, по отношению к нам, чем шимпанзе. Хотя этот вид от нас настолько далёк, в биологическом плане, что даже не скрещивается с нами. А вот представители человеческой расы, которые хоть и дают потомство, при скрещивании с нами, почему-то от нас дальше, чем обезьяны.
Эволюция - одним словом.
А пипл хавает...

Я тоже из рода БТ.
Однако мой М91=Т9 не есть родом из от шимпанзе, а то я не есмь родом из от обезьяны,
но от Адама, а он от какого-то первочеловека, может быть от Оррорина
(жил примерно 6 миллионов лет назад).
От него походит и современный человек, и шимпанзе.
Мутация Т8->Т9 наступила в BТ, безотносительно от шимпанзе, как совершенно новaя мутация.

Я думаю, что аналогично стало в родах Боромирa и Шоломичa rolleyes.gif


Автор: aklyosov 12.7.2012, 18:21

Цитата(Шоломич @ 12.7.2012, 9:46) *
Цитата(aklyosov @ 10.7.2012, 13:34) *
Шимпанзе (предковая) - 9Т
Боромир (ВТ-->R1a) - 9T
А-M13 - 8T

Итог: африканская гаплогруппа А1а (снип М91) находится дальше, по отношению к нам, чем шимпанзе. Хотя этот вид от нас настолько далёк, в биологическом плане, что даже не скрещивается с нами. А вот представители человеческой расы, которые хоть и дают потомство, при скрещивании с нами, почему-то от нас дальше, чем обезьяны.
Эволюция - одним словом.
А пипл хавает...
biggrin.gif


Написана абсолютная глупость, почти в каждой фразе. Даже нет смысла разбирать. Безграмотность - чудовищная. Хотя бы взять то, что мы здесь говорим про Y-хромосому, которая никак не относится к возможности скрещивания. Скрещивание в первую очередь относится к числу хромосом, а не к одной Y-хромосоме. Так что не нужно про свои якобы познания в биологии. Не говоря о том, что по одному снипу рассуждать кто ближе или дальше - глупость несусветная.

Мне, честно говоря, непонятно, что вы здесь вообще делаете. То. что выступаете коверным - это ясно. Но непонятно, зачем, смысл? Особый вид мазохизма?


Автор: Шоломич 12.7.2012, 18:25

Цитата(Stanislaw @ 12.7.2012, 19:09) *
Я тоже из рода БТ.
Однако мой М91=Т9 не есть родом из от шимпанзе, а то я не есмь родом из от обезьяны,
но от Адама, а он от какого-то первочеловека, может быть от Оррорина
(жил примерно 6 миллионов лет назад).
От него походит и современный человек, и шимпанзе.

А как тогда Вы, пан Станислав, обоснуете такое "явление" как гг А1а,.. они что "ответвились" ещё раньше обезьяны...? biggrin.gif

Автор: Stanislaw 12.7.2012, 20:17

Цитата(Шоломич @ 12.7.2012, 19:25) *
Цитата(Stanislaw @ 12.7.2012, 19:09) *
Я тоже из рода БТ.
Однако мой М91=Т9 не есть родом из от шимпанзе, а то я не есмь родом из от обезьяны,
но от Адама, а он от какого-то первочеловека, может быть от Оррорина
(жил примерно 6 миллионов лет назад).
От него походит и современный человек, и шимпанзе.

А как тогда Вы, пан Станислав, обоснуете такое "явление" как гг А1а,.. они что "ответвились" ещё раньше обезьяны...?

Научная антропология не проповедует, что человек есть родом из от обезьяны.
Что походит от обезьяны учила нас в школах только сталинская-ленинская антропология, когда имела в Польше власть.
Учебники так писали, а учителя не велели в это верить... biggrin.gif

Научная aнтропология подчеркивает, что человек и шимпанзе это сегодняшние существа.
Шесть миллионов лет нaзaд их нет. Были какие-то их предки.
Может напр. Оррорин...


Автор: aklyosov 12.7.2012, 21:13

"Обезьяна", дорогой Stanislaw, это в данном контексте обобщенное понятие.

На известную цитату "труд превратил обезьяну в человека" не стоит просить уточнения, какую именно обезьяну, какого рода и вида. Есть понятия, которые мы понимаем с полуслова.

Так, например, мы все понимаем, что в предках человека не только были обезьяны, но и рыбы, и даже, пардон, бактерии. Так что не стоит думать, что в наших предках были только прямоходящие. Были и кривоплавающие.


Автор: Анфиса 13.7.2012, 9:08

Цитата(aklyosov @ 12.7.2012, 22:13) *
Так, например, мы все понимаем, что в предках человека не только были обезьяны, но и рыбы, и даже, пардон, бактерии.

А также сюда можно добавить и неживую природу со всей таблицей Менделеева. В общем, из праха в прах…

Автор: Stanislaw 13.7.2012, 18:56

Цитата(Анфиса @ 13.7.2012, 9:08) *
Цитата(aklyosov @ 12.7.2012, 22:13) *
Так, например, мы все понимаем, что в предках человека не только были обезьяны, но и рыбы, и даже, пардон, бактерии.

А также сюда можно добавить и неживую природу со всей таблицей Менделеева. В общем, из праха в прах…
Именно так!
Ведь даже Библия говорит: "Tы из пороха и ты в порошок повернешься!" biggrin.gif
....
А с другой стороны - была тоже такая идеология, что шимпанзе теперь такой, какой был 6 миллионов лет назад, такая горилла, какой былa 10 миллионов лет назад, а только человек эволюционирует, идет вперед, перепрыгивает из одного вида на второй, имея отчетливо назначенное направление развития и окончательный его цель.
Этому, который это выдумал, Нобеля!


Автор: Odin 13.7.2012, 21:03


http://s008.radikal.ru/i304/1207/c4/dcd0cc1a62f9.jpg

Автор: Odin 13.7.2012, 21:59

A0 = P305 почему групируется вместе с BT?
Может BT тоже P305+?

Автор: Люда 13.7.2012, 23:23

Odinhttp://s008.radikal.ru/i304/1207/c4/dcd0cc1a62f9.jpg
Что это? Непонятно.

Цитата
A0 = P305 почему групируется вместе с BT?
Может BT тоже P305+?

А1= P305+, А0=Р305-.

Автор: aklyosov 14.7.2012, 0:40

Уважаемый Odin,

Просьба не засорять эту важную тему всякими самодеятельными диаграммами, тем более без своих авторских комментариев и обсуждений. Иначе тема будет погребена под мусором. Непонятно, кто автор, на каком основании построена, что при этом принято во внимание, какие допущения сделаны. Тогда тема превращается в свалку и базар.

Автор: Stanislaw 21.7.2012, 16:48

Чтобы присмотреться, сколько может появиться нашим глазам мутации между человеком и шимпанзе (то есть 2 x 6 миллионов лет), я выполнил такой опыт.
Я пользуясь таблицей 22 медлительных маркеров, по подсчетам и упростeнию, отнес первому, наиболее медлительному DYS472 - 5 мутаций, второму 5 x 5 = 25, третьему 6 x 5 = 30, и т. д., уместно к таблице скорости мутации.
Всех мутаций есть тогда 3000 и дадут они время: 3000: 0.006 = 500,000 поколений.
По умножeнию через 25 дает 12,500,000 лет между человеком а шимпанцем, через общего предка, условнoгo Оррорина.

Бросая порцией пяти монет для обудву линии вместе с тем (то есть к два контейнерам), я добился такие результаты

DYS... количество мутации.. результаты для Человека и Шимпанзе... и конечный результат

DYS472, 1x5=5......результ.: +1 -1 = +0; и +2 -1 = 1........... видимые мутации: GD=1
DYS425, 5x5=25... результ.: +3 -9 = -6; и +5 -8 = -3.......... видимые мутации: GD=3
DYS436, 6x5=30... результ.: +12 -6 = +12; и +7 -5 = +2.... видимые мутации: GD=10
DYS426, 9x5=45... результ.: +15 -9 = +6; и +5 -16 = -7.... видимые мутации: GD=13
DYS490, 13x5=65. результ.: +17 -16 = +1; и +15 -17 = -2. видимые мутации: GD=3
DYS454, 16x5=80. результ.: +19 -22 = -3; и +20 -19 = -1.. видимые мутации: GD=2
DYS455, 16x5=80. результ.: +28 -20 = 8; и +18 -14 = 4..... видимые мутации.GD=4
DYS578, 17x5=85. результ.: +25 -24 = +1; и +16 -20 = -4..видимые мутации: GD=5
DYS641, 17x5=85. результ.: +20 -21 = -1; и +18 -26 = -8...видимые мутации: GD=7
DYS590, 17x5=85. результ.: +22 -19 = +3; и +24 -20 = +4.видимые мутации: GD=1
...........................
...........................
...........................
Я перебил более далекие подсчеты.
Потому что что толку более далекого счета?
Какая связь числа возникнутыx мутаций с количеством мутаций видимых, дающихся прочитать?

Таблица 22-маркэрова - хорошая мысль, я подходил к этой инициативе всегда без предупреждения, но она только для надежного ограниченного времени, где еще скорее нет повторов мутаций в медлительных маркерах уже мутированных.
Читабельный времени для Адама или шимпанзе нельзя её применять.


Автор: aklyosov 21.7.2012, 18:23

Ваши данные неверные. У нас есть настоящее (видимое) число мутаций между человеком и шимпанзе, и оно не соответствует Вашим результатам.

Вы постоянно работаете по схемам, не думая. Упираетесь в схему, и формально переносите одно на другое. Поэтому Вы постоянно делаете принципиальные ошибки.

Вот Вы уперлись в 22-маркерные гаплотипы, и не думаете, что не все есть у шимпанзе. А у Вас принцип - "Доктор сказал в морг, значит в морг".

Типа "сказано 22-маркера, значит 22 маркера".

"Нечего думать, трясти надо".

Автор: Stanislaw 21.7.2012, 18:55

Цитата(aklyosov @ 21.7.2012, 18:23) *
Ваши данные неверные. У нас есть настоящее (видимое) число мутаций между человеком и шимпанзе, и оно не соответствует Вашим результатам.

Вы постоянно работаете по схемам, не думая. Упираетесь в схему, и формально переносите одно на другое. Поэтому Вы постоянно делаете принципиальные ошибки.

Вот Вы уперлись в 22-маркерные гаплотипы, и не думаете, что не все есть у шимпанзе. А у Вас принцип - "Доктор сказал в морг, значит в морг".

Типа "сказано 22-маркера, значит 22 маркера".
"Нечего думать, трясти надо".

Я надеялся на научный ответ, а здесь зато только какое-то
традиционное побранивание моему мозгу biggrin.gif .
Я хотел только иллюстрировать, что происходит с мутациями, когда их много в одном маркере, безотносительно от того, ли встречаются они у шимпанзе ли у... кошки...


Автор: aklyosov 21.7.2012, 21:56

Дорогой Stanislaw, не надо здесь разыгрывать невинность. На что вы еще рассчитываете после ваших комментариев на разных сайтах в отношении наших работ?

Вы каждый раз разыгрываете какое-то шаманство, вам здесь это объясняют, вы идете на RootsWeb с тем же шаманством, и там вам опять объясняют, что так нельзя. Потом вы идете на молген, и там опять заводите свою песню. Пора и научиться чему- то.

И каждый раз там вы с новым ником.

Автор: Stanislaw 21.7.2012, 22:58

Цитата(aklyosov @ 21.7.2012, 21:56) *
Дорогой Stanislaw, не надо здесь разыгрывать невинность. На что вы еще рассчитываете после ваших комментариев на разных сайтах в отношении наших работ?

Вы каждый раз разыгрываете какое-то шаманство, вам здесь это объясняют, вы идете на RootsWeb с тем же шаманством, и там вам опять объясняют, что так нельзя. Потом вы идете на молген, и там опять заводите свою песню. Пора и научиться чему- то.
И каждый раз там вы с новым ником.
Снова какой-то мало научный текст! biggrin.gif

Как не хватает вам научных аргументов, тогда...
Но - так пусть будет!:(

Мое ницки не скрывают моего имени. Не новые. Я даю тоже ссылки к своим сторонам и ницкaм . Я не скрываю их.

А этот английский Molgen (а кыш!) - ведь контуаторэм знанoнo вам и употреблянoнo DNA-Forums...

Шманьство мое?
Откуда оно у меня? По-видимому заразительное... Я по-видимому слишком долго с ним общался...

”вы идете на RootsWeb с тем же шаманством, и там вам опять объясняют, что так нельзя.”
Ли только меня они не понимают? А вас..., вы не помните?
А помните вы, что сам о квалификациях этих научных работникax здесь писали?



Автор: aklyosov 22.7.2012, 1:59

Вам дали "научный текст", но вы на научные тексты не отвечаете, начинаете юлить и переключаться на прочие комментарии.

Повторяю, что расчеты ваши неверные. Например, у человека DYS426 равен 11 и 12 (в разных гаплогруппах), у шимпанзе там 8. "Видимая" разница в 3-4 мутации. Вы выше написали, что "видимая" разница должна быть 13.

Ну и что там можно обсуждать. Тем более днем раньше мы этот вопрос уже обсуждали, причем с расчетами. Вы ВСЕГДА то, что обсуждают до вас, игнорируете.

Вы уже сюда выносили, что скорость мутации в ДНК (в Y-хромосоме) равна 4х10^-9. Вам объяснили, что почти все исследователи принимают скорость в четыре раза меньше, включая Крусиани, который только недавно был для вас кумиром. Вы опять выскочили на RootsWeb с той же 4х10^-9, и объявили, что с ее использованием "Адам" жил 200 тысяч лет назад. о том, что с цифрой Крусиани (и многих других) у вас тогда было бы до "Адама" 800 тысяч лет, вы почему-то не упомянули. Это что, наука? Вам, естественно, другие на это тут же указали.

То есть картина повторяется - вы сюда приходите с каким-то мусором, вам говорят, что это не неверно, вы тут же бежите в другое место и выставляете то же самое.

Опять скажете, что ненаучный текст? А научных вы не понимаете и не воспринимаете.

Когда вы принесли суда свою безумную таблицу с безумными коэффициентами расчетов TMRCA, вам сказали и объяснили, что это абсурд. Вы побежали на RootsWeb и опять тот же мусор туда выставили. А говорите, что вам нужна наука.

Люди на RootsWeb обсуждали нашу с И.Л.Рожанским статью про Африку, и обсуждали серьезно. Вы выскочили и сказали, что это "ужасно", не приведя ни одного аргумента. Это что, наука?


Ранее вы здесь объявили, что наши с И.Л.Рожанским расчеты, что гаплогруппа A0 жила намного ранее других субкладов гаплогруппы А - это "расизм". Это что, наука?

Давно пора было понять, почему я с вами таким тоном разговариваю, и не надо строить невинность.

Автор: aklyosov 22.7.2012, 16:49

Вернемся к интересным закономерностям изменения аллелей между гаплотипами современного шимпанзе и современного человека. Между ними - примерно 12 миллионов лет.

Как много должно произойти мутаций в аллелях за эти 12 миллионов лет - теоретически, и что нам показывают фактические гаплотипы?

Возьмем для примера два маркера - DYS426 и DYS472. Константы скорости мутаций в них, вычисленные из фактических данных для современных людей, равны 0.00009 и 0.00001 мутаций на маркер за поколение, то есть одна мутация происходит раз в 11,111 поколений (278 тысяч лет) и в 100 тысяч поколений (2.5 миллионов лет), соответственно. За 12 миллионов лет должны - в среднем - произойти 43 и 4.8 мутаций, соответственно в этих двух маркерах.

А на самом деле?

А на самом деле у шимпанзе DYS426=8, у человека базовая аллель равна 11 для наиболее старых гаплогрупп. То есть на самом деле в DYS426 за эти 12 миллионов лет произошли 3 видимых мутации вместо 43. Остальное съели возвратные мутации. То есть коэффициент между видимыми и "действительными" мутациями для DYS426 равен (43 делим на 3) примерно 14. Теоретический коэффициент равен 11. То есть мы видим неплохое совпадение между теорией и наблюдениями. Разницу легко объяснить, если взять для скорости мутации DYS426 не 0.00009, а 0.00007, тогда мутация происходит раз в 357,140 лет, всего ожидается 33.6 мутаций, и отношение между наблюдаемыми и ожидаемыми мутациями равно 11.2. Формула дает 11.

Для DYS472 у шимпанзе аллель равна 5, у современного человека она равна 8. Опять всего 3 видимых мутации, вместо 4.8 теоретических. Для данного случая коэффициент между видимыми и "действительными" мутациями для DYS472 равен 1.6. А в теории он должен быть равен 11. Опять, поскольку константа скорости мутации для DYS472 является сугубо оценочной (одна стотысячная), то теория будет сближена с практикой при константе скорости мутации, равной, например, 0.00005. Тогда мутация происходит раз в 20,000 поколений, то есть раз в 500 тысяч лет, и за 12 миллионов лет пройдут в среднем 24 мутаций, а не 3 видимые. Отношение равно 8 при теоретических 11.

Как видно на этих двух примерах, наблюдаемые величины числа мутаций в гаплотипах шимпанзе и современного человека (или их предков в гаплогруппах) дают разницу, которая в целом вполне объясняется теорией. На самом деле мы не считаем по отдельным маркерам, мы считаем по сумме мутаций, так как в этом случае погрешности усредняются и погашаются, конпенсируются. В итоге мы получаем суммарное отклонение в 64 мутаций на 16 маркерах, то есть в среднем 4 мутации на маркер. Это несколько выше, хотя и не намного, чем 3 мутации на маркер для DYS426 и DYS472. Но и константа скорости мутации у нас 0.0041 мутаций на гаплотип на поколение, или 0.000256 мутаций на маркер на поколение, что заметно выше тех, для DYS426 и DYS472. В итоге 4 мутации на маркер дают коэфициент возвратных мутаций не 11 (для 3 мутаций на маркер), а 28, и константа 0.0041 приводит нас к тем самым миллионам лет разницы между шимпанзе и человеком: 64/0.0041 = 15,610 поколений, при умножении на 28 и на 25 лет получаем около 11 миллионов лет разницы, или примерно 5.5 миллионов лет до общего предка шимпанзе и человека.

Так что я не вижу, чтобы теория так уж отклонялась от наблюдений и расчетов.



Автор: Stanislaw 22.7.2012, 16:57

Цитата(aklyosov @ 22.7.2012, 1:59) *
Опять скажете, что ненаучный текст?

Когда в каждой сдаче появляется "вы... вы... вы..." это признак, что выходит о борьбу с партнером у дискуссии, а не о научное содержание. wink.gif

Цитата
Повторяю, что расчеты ваши неверные. Например, у человека DYS426 равен 11 и 12 (в разных гаплогруппах), у шимпанзе там 8. "Видимая" разница в 3-4 мутации. Вы выше написали, что "видимая" разница должна быть 13. .

Ну и ведь я не утверждаю, что в DYS426 различие между человеком а шимпанзе 13!
Я делал только испытать, чтобы показать - сначала себя, а потом вам, как очень ложное число видимых мутаций, когда в том же самом маркере много фактических мутаций.
В DYS426, где (в опыте) были 45 фактических мутаций, я увидел только (и целых!) 13 мутаций, a можно увидеть каждoe число от 0 (если у мутации выходят в одном направлении) к 90 (если мутации выходят в противоположных направлениax)!
Вы можете сам делать похожие опыты, бросая монету .
В таком случае в том, что мы видим, напр. в DYS426, нет никакой связи с фактическим количеством мутации.

Цитата
Вы уже сюда выносили, что скорость мутации в ДНК (в Y-хромосоме) равна 4х10^-9. Вам объяснили, что почти все исследователи принимают скорость в четыре раза меньше
Кто объяснял?
Я с аргументами, то есть темпом мутации SNP во всем геноме, уже раньше знался из учебников генетики.
Однако те же самые учебники подают, что темп мутации во выбранных отрезках DNA может быть очень разное, как отличается в mtDNA ( два разные отрезки со своими темпами: 2,4 x 10^-7 и 3,6 x 10^-6).
B Y-DNA в микросателлитax 10^-3 к 10^-4; в минисателлитax 10^-2 к 10^-1.
Мутации SNP в NRY еще нет синдицировали; у нас не обозначения ни их число.
Мы не знаем, сколько из 57.000.000 нуклеотыдов NRY может быть для генеалогии: 24-, 26 миллионов?
А какой их темп?
В многочисленных публикациях писается о более высшем темпе, чем весь геном.
Wikipedia цитирует, что 4.8 разы. Но я к полным статьям не имею доступа.
Нет однако основания к оспаривать.
......................
Или давайте проверяем сами.
ISOGG/Krahn подает под BT примерно 115 мутации SNP.
Деля их на 400000 b.p. (WTY у Крагна) я получаю 0.0002875 SNP на 1 b.p.
Деля этот результат через 0,000.000.004 (4х10^-9) SNP в год
я получаю 71,875 лет к коалесценцйи BT.


А вы? Умножьте эти 71,875 лет через 4!!

Цитата
Когда вы принесли суда свою безумную таблицу с безумными коэффициентами расчетов TMRCA, вам сказали и объяснили, что это абсурд. Вы побежали на RootsWeb и опять тот же мусор туда выставили. А говорите, что вам нужна наука.
Моя таблица ФТМ старалась решить проблему многократно повторяющихся мутаций в одном маркере, подобно вам, создавая таблицу 22-маркэровом.
Я теперь вижу, что одна и вторая абсурдом: эти повторяющиеся мутации вообще не даются посчитать.

Цитата
Люди на RootsWeb обсуждали нашу с И.Л.Рожанским статью про Африку, и обсуждали серьезно.
Я поздравляю, но у меня не было такое впечатление относительно одобрения вашей публикации о гаплoгрупе А.

Цитата
Ранее вы здесь объявили, что наши с И.Л.Рожанским расчеты, что гаплогруппа A0 жила намного ранее других субкладов гаплогруппы А - это "расизм". Это что, наука?
Нет, я не забрасываю вам расизма, я только сигнализировал, что в этом такая опасность сидит.
Оно и в антропологии Дарвина..., на неё ссылались британские расисты на Тасмании.


Автор: aklyosov 22.7.2012, 17:02

Теперь о том, что за "сдерживающий фактор" держит аллели и не позволяет им уходить очень далеко от предковых значений. Этот "сдерживающий фактор" и есть чистая статистика.

Допустим, скорость мутации маркера является "канонически средней", 0.002 мутаций на маркер, то есть мутация происходит в среднем раз в 500 поколений, то есть раз в 12500 лет. За миллион лет должно произойти в среднем 80 мутаций в одном маркере.

Попробуйте бросить монету 80 раз подряд, и считайте орел за мутацию "вперед", и решку - за возвратную мутацию. И что в итоге получится? Либо в среднем 40 орлов и 40 решек, и тогда аллель какой была, такой и осталась через миллион лет, либо что-то типа 42 орла и 38 решек, и тогда аллель уйдет всего на две мутации. Вот и весь "сдерживающий фактор".

Действительно, в этом варианте применение формулы, которую здесь называют формулой Клёсова-Адамова, даст астрономический вариант отличия фактического число мутаций от наблюдаемого. Так он и есть астрономический. В случае равного количества выпадений орлов и решек аллель не сдвинется (число наблюдаемых мутаций равно нулю), а теория дает 80. Отношение - бесконечность. Формула и дает практически бесконечность, поскольку там будет е^80. Она же основывается на статистике, а при 80 бросках среднее и есть практически ноль (с погрешностью в 11% при одной сигма).


Автор: aklyosov 22.7.2012, 17:20

Цитата(Stanislaw @ 22.7.2012, 8:57) *
Цитата(aklyosov @ 22.7.2012, 1:59) *
Люди на RootsWeb обсуждали нашу с И.Л.Рожанским статью про Африку, и обсуждали серьезно.
Я поздравляю, но у меня не было такое впечатление относительно одобрения вашей публикации о гаплoгрупе А.


Опять юлите? Повторяю, что люди обсуждали, и обсуждали серьезно. Были всего два негативных комментария - Бонни Шрак и ваш. Ни тот, ни другой не был мотивирован. Бонни тут же осадили (не я), что пусть она у себя порядок наведет. А вы появились, бросили, что диаграмма в нашей статье - "ужасно", ни слова мотивировки, и удалились. Вот я и спрашиваю - какую "науку" вы здесь исповедуете?

Я приветствую критику, но тогда, когда она сопровождается обоснованием. Так, как вы делали на RootsWeb - это возмутительно. И вы, повторяю, строите здесь невинность.

Автор: Люда 20.9.2012, 19:49

Решила посмотреть эту тему - что там с Перри? Обнаружила, что на 1ой стр. новая версия Древа от 01.09.(без всякого объявления). Р305 опять переместился в А0.

Автор: Люда 21.9.2012, 13:32

9.5.2012, 22:17 Сообщение #187

Цитата
Прошла еще раз по Табл.Ted Kandell и своим сравнениям.
1) Тоже так считаю, те снипы Перри, в которых стоит нуклеотид шимпанзе, переходят к нам.
Это L1085,1089, 1090,1093,1098,1099,1101,1105,1116,1117,1123,1124,1125,1127,1128, (в Табл. нет, но тоже относятся сюда-1130,1132,1135,1136,1137), 1142,1143,1145,1150,1153,1155.
2) Не поняла, почему L1112 переместился из Y0 в А0?
3) Не понимаю, почему Р305 снип А0, по-моему он должен быть в А1.
4) Не вижу в Табл. L986. На схеме он в А0, а должен быть в А1 (найден в А0 -"G", у шимпанзе "А").


На 1.09. почти все снипы стали в соответствии с этим майским сообщением. Р305 и L986 только опять стоят у А0, хотя летом их переносили в А1, где они и должны быть. L1085 что-то вообще не вижу. L1112 и 1118 должны быть у А0, а не у А1. L1144 в А1 - наверно опечатка, следует читать L1142.
Относительно А0 ничего понять пока невозможно. Что означают знаки вопросов? Снипы, которые весной были даны как Перри (L1085-1163) теперь общие для всех А0?

Автор: Right & Midfield 30.9.2012, 17:56

Цитата(Люда @ 20.9.2012, 20:49) *
что там с Перри?

I. Как и предсказывалось - гуляет по ветвям smile.gif
На наш взгляд - если уж они догматизировали один из нескольких возможных вариантов (см. шесть равновероятных с точки зрения комбинаторики вариантов - на листе scheme из прилагаемого файла excel), то уж надо идти до конца, честно говорить о том, что избрали Perry=Root, и не запутывать хотя бы своих собственных последователей. Однако мы этого не наблюдаем, и убеждаемся в том, что к науке - вся эта катавасия с укоренением дерева под цели "Африканской" гипотезы - не имеет никакого отношения.

Науке - всё равно, кто был "главным" сыном Адама, т.е. сохранил снипы Адама. Догматикам же - важна идеология, поэтому "главным" - они объявляют "старшего". Так тоже могло быть, но могло быть и наоборот.
Доказать или опровергнуть ту или иную гипотезу - пока невозможно. Значит с точки научного подхода - это пока "открытая проблема", и укоренять дерево тем или иным способом - попросту вредно для дальнейших непредвзятых исследований.

II. Однако если догматики допустят это самое "наоборот", то есть что у Адама были снипы гаплогруппы BT, то концепция "из Африки" - летит ко всем чертям. Придётся тогда детям в школе объяснять, что сейчас на планете проживает не один подвид Хомо Сапиенс, а несколько. Придётся объяснять, что 99% человечества - имеют TMRecentCA 40-50 тлн (формирование кроманьонца), и TMAncientCA 70-75 тлн (катастрофа Тоба),
но меньше 1% человечества имеют с остальным человечеством TMRCA 130-160 тлн, и ещё есть реликты с которыми TMRCA уезжает за 200-250 тлн. А детям в школе - что 200-250 тлн до родных братьев из одного вида сапиенсов, что 300-400 тлн до двоюродных братьев из другого вида неандертальцев - может показаться одинаково далеко от их собственного TMRCA в 40-75 тлн.

III. И с неандертальцами тоже придётся разбираться. Если будет окончательно доказано, что у нас всё-таки есть немножко их генома, но нет ни отцовских ни материнских маркеров неандертальцев, то гибридизация шла так:
1 шаг. Папа неадерталец (maleN)+ мама сапиенс (femaleS) = бесплодные сыновья (maleNS) и фертильные дочери (femaleNS).
2 шаг. Фертильные дочери (femaleNS) + мужчины сапиенсы (maleS) = фертильные сыновья и дочери, т.е. мы.
Тогда как раз и получается, что хотя один "дедушка" у нас неандерталец, но Y-DNA от неандертальцев у нас нет, потому что они замещены Y-DNA сапиенсов из второго шага; а mt-DNA неандертальцев и быть не могло, потому что обе "бабушки" - сапиенсы.

Но дети в школе - обычную биологию тоже проходят, про лошака и мула тоже читают, про сложности межвидовой гибридизации - понимают. Биология, как наука - вполне допускает и межвидовую гибридизацию животных (в т.ч. человека) и образование подвидов (в т.ч. у человека).
Но догматикам очень не захочется объяснять детям в школе, что большинство человечества - продукт межвидовой гибридизации, а те кто не смешивался с неандертальцами и вроде бы является "истинным сапиенсом", тоже живущим среди нас - из Африки не выходил, но и из каменного века... тоже не выходил.

IV. ДНК-генеалогии, как науке - до всех этих социально-идеологических сложностей дела нет, это попросту не её функция; но ДНК-генеалогию намеренно вовлекают в решение совсем других вопросов, привлекают на помощь вполне определённой "Африканской" иделологической догме, которая лоббируется не только, и не столько в ДНК-генеалогии.

Разумеется, что нельзя "всё бросить", и обидеться на догматиков, дружно взявших под козырёк и перерисовавших деревья в 2012 году. Надо продолжать разбираться, и мы пока (для себя) взяли за рабочую основу - компромисс (может быть и не самый неправильный, но самый нейтральный). См. листы tree и flat из прилагаемого файла excel).
Пароля на файл нет.
http://rusfolder.com/32891957

Автор: Igor1961 1.10.2012, 3:33

Любезный Правый Полузащитник, Вы хоть понимаете, насколько легковесны все Ваши умопостроения и схемы, подозрительно напоминающие игру в морской бой? А уж делать из всего этого выводы про фертильность-нефертильность - это вообще из серии "в огороде бузина, в Киеве дядька". С тем же успехом можно в Экселе переставлять цветные квадратики, обозначающие кварки, всерьез полагая, что это решит какие-то проблемы в теории элементарных частиц.

Наука так не делается. Привлекайте сведения из других дисциплин, сравнивайте, анализируйте, оптимизируйте, а не развлекайтесь игрой в кубики. К слову, нашими общими усилиями уже удалось показать, где на дереве мог находиться корень, для чего привлекли снипы шимпанзе. Читайте дискуссию в этой и соседней ветках.

И большая просьба избегать фразеологии, явно позаимствованной из лексикона Председателя Мао или незабвенного Трофима Денисовича. Никто не будет вести дискуссию с оппонентом, который подменяет научную аргументацию навешиванием ярлыков. Это все равно, что играть в карты с заведомым шулером. Обыграть его может только еще более ловкий шулер, но не чемпион в игре по правилам. Если в последующих сообщениях опять будут рассуждения о "догматиках", "идеологах" и т.п., они (сообщения целиком) будут удаляться как спам, не имеющий отношения к предмету дискуссии.

Автор: Люда 1.10.2012, 7:28

Right & Midfield
Не поняла, в чем суть Ваших предложений- предположений.
А про такую гипотезу нахождения неандертальских генов в нас я где-то здесь рассказывала, приводя картинку из статьи -P. H.Mason and R.V. Short “ Neanderthal-human hybrids” Hypothesis v.9, N1, 2011

Автор: aklyosov 1.10.2012, 14:00

В общем, все дискутанты в определенной степени правы. Ненаучные термины здесь привлекаются только что разве для эмоций, что, действительно, только засоряет суть.

Что на самом деле имеем?

1. Нет никаких четких доказательств "выхода из Африки" современного человека в последние 50-200 тыс лет. Всевозможные натяжки и фантазии в счет не идут. Это касается и антропологии (с их произвольными интерпретациями), и (якобы)лингвистики, и попгенетики, включая построения неукорененные деревьев, которое им жутко хочется привязать именно к Африке.

2. Нет никаких четких доказательств о том, что в нас есть якобы "гены неандертальца". Публикации в "академической литературе" идут чехардой, поочередно опровергая друг друга. Опровергнуты и печально известные "1-4 процента" якобы в нас от неандертальцев, поэтому ясных и непротиворечивых данных нет.

А что есть?

1. Есть общий предок у современного человека и шимпанзе, и в нашей последней работе с тремя представленными здесь авторами (принята к печати) ДНК-генеалогия этой наследственности по Y-хромосоме детально рассмотрена, включая 16-маркерные гаплотипы между шимпанзе и человеком.

2. Неандерталец разошелся с современным человеком примерно между 300 и 500 тысяч лет назад, но чернокожим неандерталец не был. Он был, как показывают исследования, рыжеволосым и вполне светлокожим. Это означает, что современный человек неафриканского происхождения не проходил через негроидную фазу развития. Это означает, что наши предки не вышли из Африки не только 50-200 тыс лет назад, но и 300-500 тысяч лет назад.

3. Данные ДНК-генеалогии современных неафриканцев могут интерпретироваться равнозначно - либо они потомки альфа-гаплогруппы неафриканского происхождения, с образованием последующей бета-гаплогруппы (ВТ) и далее всех нас, либо эти снип-мутации проходят через Африку, и альфа-гаплогруппа - африканского происхождения. Но пункт 2 выше противоречит африканскому происхождению современного человека.

4. Есть древняя чернокожая линия в Африке, называть ее А0, или как-то по другому. Но откуда она там появилась - пока совершенно непонятно, опять же в свете п. 2 выше. Иначе говоря, она должна быть намного древнее неандертальцев, и намного древнее времени расхождения предков современного человека и неандертальцев. Это - исходная чернокожая, негроидная линия, совершенно отличная антропологически от неафриканцев.

5. В Африке есть самые разнообразные антропологии чернокожих, и разнообразные гаплоогруппы и субклады. Вместе они составляют огромное разнообразие, вариации всех антропологических, генетических и ДНК-генеалогических характеристик. Это совершенно безграмотно долгие годы принималось за доказательство "африканского происхождения человека", типа "раз древние - то непременно предки".

Как это все объяснить? А вот так, как вариант:

Из глубин 6-7 миллионов лет назад, или еще древнее, поднимались несколько генеалогических линий, выживших до настоящего времени (и бесчисленное количество линий, которые не выжили). Две из них - это (а) потомки общего предка современного человека и современного шимпанзе, и (б) потомки чернокожей линии, получившей сейчас условное название А0 (хотя назвать можно как угодно). Возможно, на каком-то этапе это была одна общая генеалогическая линия, объединявшая а/б.

Эта линия разошлась на три генеалогические линии. Одна, "А0", отошла первой (или не отошла, а шла параллельно), и она была негроидной, чернокожей. Она ушла в Африку или всегда была в Африке. Другая линия, нечернокожая, разошлась 300-500 тысяч лет назад, на неандертальцев и на будущих Homo sapiens. Неандертальцы были светлокожие и рыжие (хотя могли быть и шатены и какие угодно), как и предки современного человека. Будущие H. sapiens вышли на альфа-гаплогруппу, от которой отошла линия, которая ушла в Африку между 160 и 120-100 тысяч лет назад. Там они смешались с чернокожими и сами стали чернокожими. Это - гаплогруппа А (в разных вариантах). Остальные продолжали быть неафриканцами, и образовали бета-гаплогруппу примерно 64 тысячи лет назад. Возможно, их предков (живших от 160 до 60 тыс лет назад) истребил вулкан Тоба, возможно, они вымерли по другим причинам. Но общие предки современных неафриканцев уходят только на 64 тыс лет назад. Они и заселили Землю с тех пор, включая австралийских аборигенов, монголоидов и европеоидов.
Гаплогруппа В тоже ушла в Африку (уже после 60 тыс лет назад, возможно и 50-40 тыс лет назад), и тоже стала там негроидной, увеличив "разнообразие".

Естественно, свой и серьезный вклад в антропологию современного населения внесли женщины, меняя эту антропологию по своим направлениям (например, лопатоподобные резцы у монголоидов имеют непонятное и очень древнее происхождение).

Вот такая общая схема. Я пока не вижу, что бы ей противоречило.

Комментарии?

Автор: bugler 1.10.2012, 17:23

Комментарии:
<Из глубин 6-7 миллионов лет назад, или еще древнее, поднимались несколько генеалогических линий, выживших до настоящего времени (и бесчисленное количество линий, которые не выжили). Две из них - это потомки общего предка современного человека и современного шимпанзе, и потомки чернокожей линии, получившей сейчас условное название А0 (хотя назвать можно как угодно).>
Здесь надо объяснять чем отличается линия А0 от предков «анатомически современного человека» и в конечном итоге, чем отличается современный человек от А0. На мой взгляд гиблый вариант.
<Возможно, на каком-то этапе это была одна генеалогическай линия.>
Скорее всего так и есть. Если рассматривать линию, как прогрессирующее общество, то отделение – это специализация, а в долгосрочном плане выход за пределы вида. Похоже, это был удел шимпанзе, затем австралопитеков.
<Эта линия разошлась на три генеалогические линии. Одна, "А0", отошла от первой (или не отошла, а шла параллельно), и она была негроидной, чернокожей.
>
Черная кожа это отпечаток тропиков. Негроиды и Дравиды черные, причём чернота обусловлена разными генетическими признаками.
<Она ушла в Африку или всегда была в Африке.>
До 2 млн. лет назад – в Африке ( только потому, что нашли самые древние останки и самые древние орудия труда).
< Другая линия, нечернокожая, разошлась 300-500 тысяч лет назад, на неандертальцев и на будущих Homo sapiens.>
1000-800 тыс.л.н сформировался «гейдельбергский человек» - социальное существо лесной зоны. Европейская популяция начала специализироваться на охоте в условиях умеренной зоны и сформировала к 130 тыс. л.н. классических неандертальцев. Африканскую популяцию засуха выдавливала из субтропиков в тропические леса и заставляла жить в саване это и были А0. Азиатская популяция скорее всего вымерла. На Ближнем Востоке стала формироваться альфа-гаплогруппа. Она была в лучших условиях обитания, чем африканская и неандертальцы.
<Неандертальцы были светлокожие и рыжие (хотя могли быть и шатены и какие угодно), как и предки современного человека.>
Надёжных доказательств светлокожести и рыжести нет. Но в антропогенезе человека современного участие принимали. Вопрос только как. Скорее через женщин, потому что совместно не жили (доказательств нет).
<Будущие H. sapiens вышли на альфа-гаплогруппу, от которой отошла линия, которая ушла в Африку между 160 и 120-100 тысяч лет назад. Там они смешались с чернокожими и сами стали чернокожими. Это - гаплогруппа А (в разных вариантах). Остальные продолжали быть неафриканцами, и образовали бета-гаплогруппу примерно 64 тысячи лет назад. Возможно, их предков (живших от 160 до 60 тыс лет назад) истребил вулкан Тоба, возможно, они вымерли по другим причинам. Но общие предки современных неафриканцев уходят только на 64 тыс лет назад. Они и заселили Землю с тех пор, включая австралийских аборигенов, монголоидов и европеоидов.
Гаплогруппа В тоже ушла в Африку, и тоже стала там негроидной, увеличив "разнообразие".
Естественно, свой и серьезный вклад в антропологию современного населения внесли женщины, меняя эту антропологию по своим направлениям (например, лопатоподобные резцы у монголоидов имеют непонятное и очень древнее происхождение).
Вот такая общая схема. Я пока не вижу, что бы ей противоречило.
>
В остальном я за.

Автор: Right & Midfield 1.10.2012, 17:25

Цитата(aklyosov @ 1.10.2012, 15:00) *
Комментарии?

С удовольствием smile.gif

Часть первая.

1. Когда институт Макса Планка и лично Svante Paabo публиковали первые данные по различию mt-DNA неандертальцев и сапиенсов, то "по телевизору сказали", что TMRCA ~500 тлн. Т.е., найдя около 200 расхождений, усреднили вероятность возникновения мутации до 1 на 100 поколений, при возрасте поколения 25 лет. Так и насчиталось 200 х 100 х 25 = 500 000. Но неандерталец не мог иметь возраст поколения в 25 лет, от силы 15. Да и современный ему сапиенс - тоже не имел медицинской страховки, умирал (а значит и размножался) быстрее.
Таким образом - эти учёные решили подкорректироваться до ~400 тлн, т.е. возраст поколения снизили до 20 лет.
Строго говоря - и это не совсем корректно. 200 различий нашли между ископаемым неандертальцем и современным сапиенсом, и надо было отбросить те мутации, которые набежали у сапиенса, с того момента, когда неандерталец умер и мутировать очевидно перестал. Возраст ископаемого был около 40 тлн, значит 40 000 / 100 поколений по 20 человеческих лет = 20 мутаций долой. 200 - 20 = 180 мутаций между неандертальцем и сапиенсом, который был ему современником.
Далее TMRCA между ними 180 х 100 х 15 = 270 000, да ещё надо прибавить изначальные 40 000. Итого 310 тлн. Разумеется не идеально точно, однако эти учёные в последующих высказываниях - тоже пришли к цифре в ~300 тлн, т.е. подкорректировали свою точку зрения ещё раз.

2. Та же история пронаблюдалась у института Макса Планка и с денисовцем. Значала пытались удревнить по максимуму, потом постепенно приходили к более корректным цифрам.
Различий обнаружено 385, возраст ископаемого около 30 тлн. Аналогично 30 000 / 100 поколений по 20 человеческих лет = 15 мутаций долой. 385 - 15 = 370 мутаций между денисовцем и сапиенсом, который был ему современником. Далее TMRCA между ними 370 х 100 х 15 = 555 000, да ещё плюс изначальные 30 000. Итого 585 тлн, и да поправят нас знатоки теории катастроф, но примерно тогда произошла ещё одна такая, всепланетарная.

3. А ещё у нас есть "дядюшка Идалту". Это вполне официальный подвид сапиенса, датируемый ~200 тлн.

4. Где жил общий предок эфиопского сапиенса Идалту, европейского неандертальца и алтайского денисовца? Потомство он оставил на всех трёх континентах, претендующих на "первородство"...

5. Добавим в историю - нас самих (всех ныне живущих сапиенсов, не только кроманьонцев). Пока мы определяем своего Y-Адама в ту же эпоху 200 тлн; это как минимум (может быть и ещё древнее!). Т.е. как минимум в то время - братья которых зовут Дважды сапиенс и сапиенс Идалту - уже сосуществовали. Но ведь они должны иметь ещё и общего предка! - изначального просто сапиенса, без подвидов. И вот как раз он, отец Адама и Идалту - мог сформироваться как на промежутке между его обнаруженными (может откопают ещё не обнаруженных) сыновьями (200 тлн) и неандертальцем (300 тлн), так и ДО!
Т.е. TMRCA Идалту и Адама может быть и более 300 тлн, а значит случиться даже раньше, чем расхождение неандертальца и сапиенса. И где он тогда жил, этот Первый сапиенс?


Часть вторая.

1. Когда мы читаем у Вас фразу "намного древнее времени расхождения предков современного человека и неандертальцев", то нам это не кажется невероятным, невозможным, фантастическим -
наоборот, как показано выше в первой части - такая история действительно могла иметь место.

2. Первый сапиенс - мог жить где угодно, в том числе в Африке, но вовсе не обязательно в Африке.
На наш взгляд - эта проблематика вообще имеет всё меньшее и меньшее значение (для ответа на вопрос - откуда взялись кроманьонцы). Вот когда Y-Адама определяли по возрасту как 70 тлн, а Идалту был и вовсе не известен науке, тогда сторонникам африканской гипотезы - было очень важно. Но теперь, когда Y-Адам определяется всё глубже и глубже на временнОй шкале, а уж отец Адама и Идалту - и вовсе "уезжает" в такие далёкие времена, что становится не важно - откуда он "есть пошёл". Прямого влияния на кроманьонцев - место рождения Первого сапиенса - уже не имеет. И уж тем более не имеет принципиального значения - где жил общий предок сапиенсов, неандертальцев и денисовцев.

3. На наш взгляд - гораздо важнее ближайшая к нам "точка обнуления", т.е. планетарная катастрофа 70-75 тлн. И чем более древними с помощью ДНК-генеалогии становятся африканские линии - тем важнее понимать, что не так уж и важно, кто от кого произошёл. Важнее, что неандертальцы воспользовались ситуацией катастрофы и последовавшего похолодания, пришли из Анатолии и жёстко разделили сапиенсов на две части: BT и хBT у мужчин; MN и хMN у женщин. Географически заняли проход между Африкой и Евразией на длительный промежуток времени между 70-75 тлн и 40-45 тлн.

Предположим, что Первый сапиенс жил в Евразии, тогда BT и MN являются его автохтонными потомками (Кавказ? Русская равнина? Иран? Индия?).
Предположим, что Первый сапиенс жил в Африке, тогда BT и MN успели ДО катастрофы 70-75 тлн - перебежать за линию "плодородного полумесяца" (Ближний Восток - Месопотамия)... в те же вышеперечисленные места, севернее и/или восточнее неандертальского клина.
Ну и какая разница, кто от кого произошёл, если xBT и xMN остались в Африке, никогда оттуда не выходили, к формированию кроманьонца отношения не имеют ни физиологически, ни так сказать "как личности"?

Нам сторонники африканской гипотезы в течение какого-то времени пытались доказать обратное, что BT и MN были где-то рядом географически и по времени. Но ДНК-генеалогия, показывающая всё бОльшую и бОльшую древность африканских линий, их удалённость от неафриканских - убеждает в абсолютной непричастности африканских линий - к формированию современного человека.
Непосредственные предки BT мужчин и MN женщин - на момент катастрофы 70-75 тлн - УЖЕ жили очень далеко от Африки, жили примерно около тех мест, где потом "породили" со-о-овсем других сапиенсов, т.е. кроманьонцев, очень сильно отличавшихся и от неандертальцев, и от денисовцев, и самое важное - от африканских братьев-сапиенсов.

4. Итого: нам кажется, что Ваша "общая схема" выглядела бы ещё более акцентированно, если:
- не забыть про алтайских денисовцев, безусловно повышающих вероятность проживания общего предка денисовцев, неандертальцев и сапиенсов - не в Африке. И по времени - денисовцы "отпочковались" не так давно, как нам пытались удревнить.
- не забыть про женщин MN, проблематика взаимосвязи которых с xMN - в ДНК-генеалогии по сути такая же, как и у мужчин. Женщины хMN - не участвовали в формировании кроманьонцев.
- не забыть про неандертальцев (неважно пока, повлиявших на наш геном или не повлиявших) физически разделивших сапиенсов после катастрофы на две части - африканскую и неафриканскую.

Автор: Igor1961 1.10.2012, 19:13

Цитата(aklyosov @ 1.10.2012, 20:00) *
Комментарии?

Чтобы было представление о теме разговора, вот деревья всех известных ныне 67-маркерных гаплотипов гаплогруппы А. За время, прошедшее с публикации статьи в Advances in Anthropology, их список га гаплогруппном проекте немного увеличился усилиями спонсоров.

Сначала дерево, построенное по медленной 22-маркерной панели:

http://www.radikal.ru

Зеленые кружки отмечают представителей Ближнего Востока и Средиземноморья, синие - западноевропейцев, черные - афроамериканцев. Как и прежде, хорошо видны компактные в этом формате ветви A1b1b (слева внизу) и А1а (вверху), но с появлением новых данных становится видно, что гаплотипы, отмеченные на проекте как А0а и A0b (от Simms до Cornelius) явно сходятся к однму общему предку. Правда, жил он очень давно - около 55 тыс. лет назад, как воспроизводимо получается несколькими методами. Это тот же порядок величины, как, например, возраст сводной гаплогруппы К.

Несмотря на столь солидный возраст, география этой гаплогруппы довольно компактна - Simms и тройка Jones-Morten-Cornelius имеют "кузенов" в более коротких форматах из Ганы, Boon - из Камеруна (народность Нсо и пигмеи Бакола). Среди бушменов, по которым имеется достаточно репрезентативная выборка, эта гаплогруппа не найдена, зато в статье Кручиани упоминаются марокканские берберы - носители снипа Р114 (A0a1 в текущей нотации).

Как и прежде, Перри (A*) находится на большом удалении от всех остальных. Его африканская родня - представители народности Бамилеке из западного Камеруна. Любопытно, что Бамилеке уже тестировали в одной из работ итальянских попгенетиков, но нашли у них исключительно гаплогруппу Е. Правда, выборка была 55 человек на двухмиллионный этнос, так что упустить родственников Перри могли запросто.

Чтобы иметь представление о возрасте ветвей, что дают серии идентичных гаплотипов в медленной панели, привожу дерево той же выборки в 67-маркерном формате:

http://www.radikal.ru

У ветвей А1а и A1b1b появилась глубина. счет по всей совокупности гаплотипов, включая более короткие форматы, дает возраст около 6500 лет назад как для первой, так и второй. Очевидно, мы видим след демографического роста, начавшийся с освоения производящего уклада в субсахарской Африке. Доминирующий в Африке субклад E1b1a, явно коррелирующий с языками семьи Нигер-Конго, сходится к тому же самому времени.

Однако, с древними ветвями А0/A* алгоритм уже не справляется в 67-маркерномом формате, и программа явно занижает их реальный возраст.

Интересно, имеются ли какие-либо данные по костным останкам в субсахарской Африке, что попадли бы на время зарождения и роста гаплогруппы А0? То есть, 45-55 тыс. лет назад. Если есть, то где найдены и какие морфологические черты имеют?

Автор: Right & Midfield 1.10.2012, 20:00

Цитата(Люда @ 1.10.2012, 8:28) *
А про такую гипотезу нахождения неандертальских генов в нас я где-то здесь рассказывала, приводя картинку из статьи -P. H.Mason and R.V. Short “ Neanderthal-human hybrids” Hypothesis v.9, N1, 2011

Ну, на наш взгляд - ничего сложного в том или ином видении способов гибридизации - нет. Достаточно общих знаний о том, как это бывает у млекопитающих. Просто иногда встречается мнение, что мол раз у нас нет Y-DNA и mt-DNA неандретальцев, то и гибридизации не было. На самом деле - могла быть, и при этом не оставить маркеров. И хотя мы пока не считаем гибридизацию сапиенсов с другими видами - делом решённым и доказанным, справедливости ради - надо учитывать такую возможность, а также тот факт, что мы не всегда сможем обнаружить такую гибридизацию средствами ДНК-генеалогии, которая изучает в первую очередь маркеры.

Цитата(Люда @ 1.10.2012, 8:28) *
Не поняла, в чем суть Ваших предложений - предположений.

Вы спросили про Perry - мы ответили. Может быть не очень понятно, попробуем подробнее:
1. Случайно или намеренно, но Cruciani не исследовал снипы в группе A1* (в нотации ISOGG 2011). Может быть у него просто не оказалось под рукой образцов, ибо группа редкая.
2. Далее Cruciani пишет, что воспользовался программой. Но программа - она не плохая и не хорошая, не добрая и не злая - это просто определённый алгоритм. Ему на входе дали много снипов из остальных ключевых групп - он их как-то взаиморасположил, а root поместил на свободное место, т.е. на то место, где в ISOGG 2011 была группа A1*. Это произошло закономерно с точки зрения алгоритма, но случайно с точки зрения здравого смысла. Если бы у алгоритма были снипы представителей группы A1*, но не было снипов например представителей A2/A3 (в нотации ISOGG 2011), то алгоритм поместил бы root на другое свободное место, т.е. на место группы A2/A3.
3. После того как работа была опубликована, а деревья переукоренены - нашёлся Perry. Раньше он просто попал бы в группу A1* и никто бы не удивился. А теперь ему пытаются (полгода уже) - найти место ниже root, перекидывают с ветки на ветку, или пытаются придумать новую ветку. Потому что люди либо не понимают, либо не хотят понимать, что Perry=root (в том нынешнем виде деревьев ISOGG 2012, которыми люди пользуются).
4. На круг: не стоит тратить время на вопрос "где Perry?", не стоит тратить время на попытки приткнуть его куда-нибудь ниже root на деревьях ISOGG 2012. Это увлекательная, но бессмысленная игра.
5. Таким образом, безотносительно африканской или неафриканской гипотез - мы имеем дело просто с недопониманием. Люди либо не читали Cruciani, либо недопонимают, почему алгоритм выбрал бывшую группу A1* в качестве root. То есть даже если Cruciani прав, то его выводам надо следовать корректно, а не абы как.

Автор: bugler 1.10.2012, 20:21

Цитата(Igor1961 @ 1.10.2012, 20:13) *
...
Интересно, имеются ли какие-либо данные по костным останкам в субсахарской Африке, что попадли бы на время зарождения и роста гаплогруппы А0? То есть, 45-55 тыс. лет назад. Если есть, то где найдены и какие морфологические черты имеют?
....


Самое интересное, что самые древние слои верхнего палеолита - Костёнки 12 45-52 тыс.л.н.
В Африке древнейшие слои датируются от 46 до 50 тыс.л.н. Это в Кении (Enkapune ya Muto), Танзания ( Nasera), Заир (Matupi Cave), Северная Ботсвана ( White Painting Shelter, Tsodilo Hills)
Костей и черепов нигде не нашли.

Автор: Люда 1.10.2012, 20:37

Right & Midfield

Цитата
Ну, на наш взгляд -...

Я просто отметила, что именно эта гипотеза уже опубликована в 2011 г. и здесь обсуждалась.
Цитата
люди либо не понимают, либо не хотят понимать, что Perry=root (в том нынешнем виде деревьев ISOGG 2012, которыми люди пользуются).

Этого не может быть. У нас разные снипы. Как он может быть нашим root?

Автор: Right & Midfield 1.10.2012, 21:35

Цитата(Люда @ 1.10.2012, 21:37) *
Этого не может быть. У нас разные снипы. Как он может быть нашим root?

1. Это не к нам вопрос - это к Cruciani smile.gif
2. Теоретически - может. Если принять следующие допущения:
а) "неудобные" снипы исключаются из рассмотрения по любой надуманной причине;
б) методом перебора шимпанзе - находятся такие шимпанзе, которые подходят под теорию.
в) с точки зрения комбинаторики - вариант Cruciani исключать нельзя.

П.С.
3. До тех пор пока не будет доказано обратное - мы лично придерживаемся точки зрения, что сочетание ключевых снипов группы BT - является главным претендентом на "первородство".
4. Нам не нравится насильственность переукоренения деревьев, потому что основных претендентов четверо (в нотации ISOGG 2011 это группы BT; A2/A3; A1a; A1*/A1b).
5. Сразу было понятно, что если закрепить деревья в нынешнем виде ISOGG 2012, то всё новые и новые появляющиеся реликтовые гаплотипы - будут вносить путаницу, отнимать время на разгадывание несуществующих загадок.

... и тем не менее - должна быть "справедливость для всех", в т.ч. для варианта Perry=root.

Автор: Igor1961 2.10.2012, 5:44

Уважаемые Right & Midfield (я правильно понял по значку "&" и местоимению "мы", что под этим ником пишут 2 чаловека?)! Зачем так много слов, причем в абсолютно умозрительных построениях?

Дерево, построенное с учетом снипов, STR и 3-х возможных вариантов размещения корня уже было посчитано. В нем учтены все снипы, доступные с сервера Finch2 для рассматриваемых участников WTY, как "удобные" кому-то, так и "неудобные". Достаточно зайти на эту вот ссылку:
http://www.rodstvo.ru/forum/index.php?showtopic=2866&st=180&p=90775&#entry90775

Там же - обсуждение. Советую прочесть повнимательнее, какая работа была проделана по его реконструкции. Надеюсь, многие вопросы отпадут сами собой. Статья по итогам этого исследования сейчас в печати в журнале Advances in Anthropology.

P.S. Если не согласны с исходными данными, отправляйтесь в Африку, находите "правильных" камерунцев и шимпанзе, делайте полный сиквенс их Y-хромосом и предъявляете альтернативную версию. Абстрактные рассуждения "что было бы, если бы было так, а не иначе" или голословные обвинения в подтасовке ИСХОДНОГО материала к науке прямого отношения не имеют. Вы хоть представляете, как это вообще можно проделать технически с Y-хромосомой шимпанзе, насчитывающей около 17 миллионов пар нуклеотидов?

Автор: Люда 2.10.2012, 9:15

Right & Midfield Спасибо, что поддержали эту тему. Но, вижу, у вас совсем иные представления. Непонятные по каждому пункту.

Цитата
а) "неудобные" снипы исключаются из рассмотрения по любой надуманной причине;

Как это?
Цитата
б) методом перебора шимпанзе - находятся такие шимпанзе, которые подходят под теорию.
Извините, вообще смешно.
Цитата
сочетание ключевых снипов группы BT - является главным претендентом на "первородство".
Что значит ключевой снип? А другая мутация, отличающая группу от группы-неключевая?
Цитата
BT - является главным претендентом на "первородство".
Чего первородство? 1ый сын Адама? С какой стати?
Цитата
Нам не нравится насильственность переукоренения деревьев
Мне кажется, это объективная реальность.
Цитата
всё новые и новые появляющиеся реликтовые гаплотипы - будут вносить путаницу, отнимать время на разгадывание несуществующих загадок.
Тоже - объективная реальность, филогению которой интересно разгадать.

Автор: Right & Midfield 2.10.2012, 9:53

Цитата(Люда @ 2.10.2012, 10:15) *
1. Как это?
2. Извините, вообще смешно.
3. Что значит ключевой снип? А другая мутация, отличающая группу от группы-неключевая?
4. Чего первородство? 1ый сын Адама?
5. С какой стати?
6. Мне кажется, это объективная реальность.
7. Тоже - объективная реальность, филогению которой интересно разгадать.

1. Так, как это сделал Cruciani.
2. Нам тоже было забавно, когда так поступил Cruciani.
3. У нас с Вами одинаковое понимание ключевых снипов, как мутаций отличающих группу от группы.
4. Конечно не на сына Адама.
На самого Адама, т.е. на помещение в root.
5. Не противоречит комбинаторике. Равно как и другие претенденты.
Рано или поздно MRCA найдут, и определят его ключевые снипы. Один из претендентов (разумеется на сегодняшнем уровне знаний о гаплогруппах BT; A2/A3 ; A1a ; A1*/A1b в нотации ISOGG 2011) - неизбежно попадёт в root.
6. Нам кажется, что пока ещё необъективная. Пока не доказано - вредно. Ибо объективнее - оперировать с неукоренёнными деревьями, или компромиссными вариантами наподобие ISOGG 2011.
7. Повторимся - игра интересная, но бессмысленная. Программа Cruciani поместила в root бывшую группу A1*. Perry попадает в эту группу. Значит на тех деревьях, которые переукоренили согласно гипотезе Cruciani - Perry равно root. Никакой загадки нет, разве что кроме той - зачем полгода пытаться найти ему место ниже root на деревьях ISOGG 2012?

Цитата(Люда @ 2.10.2012, 10:15) *
Спасибо, что поддержали эту тему.

И Вам большое спасибо. Эту, ну и ещё несколько подобных тем - поддерживают очень немногие люди.
Это нормально, ибо людей в первую очередь интересуют собственные индивидуальные гаплогруппы.
Да и сложностей в темах про "общие корни" - объективно много.

Автор: Igor1961 2.10.2012, 10:35

Господа Right & Midfield! Интересно, вы в форуме читаете только свои сообщения или хотя бы иногда посматриваете на другие? Пока вы развлекались комбинаторикой и, как мантру, повторяли "Cruciani-Cruciani" и "ISOGG-2011-ISOGG-2012", уважаемая Людмила, к вашему сведению, проделала очень серьезную работу по поиску SNP и STR у шимпанзе и других приматов.

Это дало принципиально новую информацию, что отсутствовала в работе "обожаемого" вами итальянца. Деревья, что выложены в теме, которую вы принципиально не хотите видеть, сделаны по результатам этой работы, а также по максимально возможному на сегодняшний день набору снипов в Y-хромосоме 13-ти участников WTY. Лично я рассматриваю ваши реплики в адрес уважаемой Людмилы "нам тоже было забавно, когда так поступил Cruciani" или " повторимся - игра интересная, но бессмысленная" как хамство по отношению к человеку, отвечавшему по материалам своей собственной работы. Cruciani, равно как и перестройки в ISOGG, тут ни при чем.

Настоятельно прошу прекратить свое словонедержание, пока не уясните, что именно было сделано по этой теме на нашем форуме в начале-сердине этого года. Хочется надеяться, вам станет стыдно за свою бесцеремонность и апломб.

Автор: Люда 2.10.2012, 11:09

Игорь, все нормально. Я так не воспринимаю, интересны разные мнения.

Автор: Igor1961 2.10.2012, 11:31

Мнение надо хоть как-то обосновывать, а не заниматься словоблудием. Лично я ни одного комментария по поводу полученных нами деревьев и датировок не увидел.

Как заезженная пластинка, звучат одни и те же фамилии и устаревшие аббревиатуры. Это давно пройденный этап, зачем мусолить одно и то же? Анатолиий Алексеевич обычно прописывает таким Вики-экспертам курс изучения материальной части.

Автор: aklyosov 2.10.2012, 12:24

Цитата(bugler @ 1.10.2012, 9:23) *
Здесь надо объяснять чем отличается линия А0 от предков «анатомически современного человека» и в конечном итоге, чем отличается современный человек от А0. На мой взгляд гиблый вариант.


Ну почему же гиблый? В принципе, есть много данных, что антропология негроидов очень значительно отличается от антропологии людей прочих рас. Раньше такие исследования были честными (см. статью "Луис Агассиз и его дагерротипы" в июльском выпуске Вестника за этот год), хотя методы исследования антропологии не очень изменились за последние полтораста лет, сейчас таких исследований почти нет по причине настойчивой политкорректности. Дело еще и в том, что есть непрерывная градация антропологии чернокожих вплоть до практически европеоидов, за счет смешивания и усреднения мужской и женской антропологии. Я не удивлюсь, что Перри на вид окажется вполне респектабельным джентльменом европейской внешности. Поэтому эти древнейшие негроидные линии, окажутся они А0, или их назовут как-то по-другому, типа "гаплогруппа W", надо искать не только в США (где живет Перри уже, наверное, много поколений), но в "черной Африке", и сочетать эти исследования с антропологическими. Вот это вполне может оказаться гиблым вариантом, потому что могут заклеймить в расизме, а любителей этого, как мы видим, и в прикладной попгенетике хватает. Вспомните Майку и Станислава.

Цитата(bugler @ 1.10.2012, 9:23) *
Черная кожа это отпечаток тропиков. Негроиды и Дравиды черные, причём чернота обусловлена разными генетическими признаками.


Да, но это общие соображения. Отпечаток мог остаться и со времен миллионов лет назад, от жизни в Африке. Поэтому та самая древняя негроидная линия в конечном итоге ведет свою эволюцию, видимо, из Африки. Но это не решает задачу, кроме того, что она шла параллельно неандертальцам, которые давно (по происхождению) не были негроидными, если вообще когда-то ими были, что не факт. Я-то выставляю более конкретное соображение, что на протяжении сотен тысяч лет, и, возможно, не менее 50-700 тысяч лет назад, шли две мужские линии - негроидная (А0 в самом древнем варианте) и не-негроидная (будущие неафриканцы). Это по некоторым торопливым соображениям приводит к агрессивным наскокам, типа - значит, вы считаете, что негры - не Homo sapiens? Наскоки глупые, потому что негры разные, как я сказал выше - вся градация антропологий, и потому, что женщины, обмениваясь с ними генами на протяжении сотен тысяч лет, делают их, крайних негроидов древней линии, Homo sapiens, передают им соответствующую антропологию и интеллект. Немало получают и обратно, не зря известный американский фильм называется "Белые люди не умеют прыгать".

Цитата(bugler @ 1.10.2012, 9:23) *
1000-800 тыс.л.н сформировался «гейдельбергский человек» - социальное существо лесной зоны. Европейская популяция начала специализироваться на охоте в условиях умеренной зоны и сформировала к 130 тыс. л.н. классических неандертальцев.


Вот и посмотрите, жил ли неандерталец в Африке. И где жил ГЧ, в какой лесной зоне.

Так что пока я не увидел серьезных возражений. Почему эту казалось бы очевидную схему не выдвигают специалисты? Ответ тот же - избегают альтернативных рассмотрений. Альтернативы вообще отсекаются на уровне подкорки. "Доктор сказал "в морг" - значит, в морг".


Автор: aklyosov 2.10.2012, 12:32

Цитата(Igor1961 @ 1.10.2012, 20:13) *
...
Интересно, имеются ли какие-либо данные по костным останкам в субсахарской Африке, что попадли бы на время зарождения и роста гаплогруппы А0? То есть, 45-55 тыс. лет назад. Если есть, то где найдены и какие морфологические черты имеют?
....


Вообще-то говоря, 45-55 тыс лет - это не возраст А0 как таковой, это возраст ветви современных А0. Как правило, такие возраста являются заниженными, порой в несколько раз. Стоит посмотреть перекрестно ("интеркладно") с другими ветвями на том же дереве, когда жил общий предок всех. Тогда у нас получалось примерно 160 тыс лет назад или древнее. Более многочисленные новые данные помогут эту дату уточнить.

Автор: aklyosov 2.10.2012, 12:37

Уважаемый R&M,

Поскольку претензии к Вам местами справедливые, я Вам предлагаю несколько изменить стиль подачи соображений. Вместо утверждений типа "Перри=root" и что там делал Крусиани и почему, попробуйте дать связное изложение от себя. Например, как это сделал выше я. То есть без лишних пассов нарисуйте сжатую последовательную картину, с датировками, перехода от общих предков с современными приматами к современому человеку - как африканцам, так и неафриканцам, проходя через неандертальцев и прочих Homo. Тогла станет ясно, что Вы пытаетесь сказать. Я, например, не схватываю, потому что много отвлекающих пассов.

Автор: Igor1961 2.10.2012, 13:09

Цитата(aklyosov @ 2.10.2012, 18:32) *
Вообще-то говоря, 45-55 тыс лет - это не возраст А0 как таковой, это возраст ветви современных А0. Как правило, такие возраста являются заниженными, порой в несколько раз. Стоит посмотреть перекрестно ("интеркладно") с другими ветвями на том же дереве, когда жил общий предок всех. Тогда у нас получалось примерно 160 тыс лет назад или древнее. Более многочисленные новые данные помогут эту дату уточнить.

Перекрестно получается все то же самое. Проделвывал расчеты, когда в А0 (без Перри) были 3 и 4 67-маркерных гаплотипа. Теперь их 5, но все воспроизводится. Похоже, это действительно какая-то старая африканская линия, что прошла через бутылочное горлышко около 55 тыс. лет назад. Кстати, у них всех совпадают аллели в самых стабильных маркерах: DYS426=12 и DYS425=del.

Автор: Люда 2.10.2012, 14:47

Цитата
это действительно какая-то старая африканская линия, что прошла через бутылочное горлышко около 55 тыс. лет назад.

Интересно.Т.е. похоже, что они, как и подгруппы бетта-группы, примерно в тот же период стали разветвляться?

Автор: bugler 2.10.2012, 21:32

Цитата(aklyosov @ 2.10.2012, 13:24) *
Цитата(bugler @ 1.10.2012, 9:23) *
Здесь надо объяснять чем отличается линия А0 от предков «анатомически современного человека» и в конечном итоге, чем отличается современный человек от А0. На мой взгляд гиблый вариант.


Ну почему же гиблый? В принципе, есть много данных, что антропология негроидов очень значительно отличается от антропологии людей прочих рас. Раньше такие исследования были честными (см. статью "Луис Агассиз и его дагерротипы" в июльском выпуске Вестника за этот год)...


Я внимательно прочёл статью "Луис Агассиз и его дагерротипы". Поэтому и заострил внимание. Но видимо слищком мягко. Тогда вопрос в лоб: " Будем считать линию А0 видом современного человека или нет?" Под современным человеком я понимаю вид, который скрещивается в любом расовом сочетании и даёт устойчивое потомство?

Автор: aklyosov 2.10.2012, 21:59

Цитата(bugler @ 2.10.2012, 13:32) *
Цитата(aklyosov @ 2.10.2012, 13:24) *
Цитата(bugler @ 1.10.2012, 9:23) *
Здесь надо объяснять чем отличается линия А0 от предков «анатомически современного человека» и в конечном итоге, чем отличается современный человек от А0. На мой взгляд гиблый вариант.


Ну почему же гиблый? В принципе, есть много данных, что антропология негроидов очень значительно отличается от антропологии людей прочих рас. Раньше такие исследования были честными (см. статью "Луис Агассиз и его дагерротипы" в июльском выпуске Вестника за этот год)...


Я внимательно прочёл статью "Луис Агассиз и его дагерротипы". Поэтому и заострил внимание. Но видимо слищком мягко. Тогда вопрос в лоб: " Будем считать линию А0 видом современного человека или нет?" Под современным человеком я понимаю вид, который скрещивается в любом расовом сочетании и даёт устойчивое потомство?


Что значит "будем считать?" Не глядя, просто из соображений чистой политкорректности, или все- таки посмотрим на индивида, как того требует наука и здравый смысл?

Носители А0 наверняка самые разные, и это зависит от антропологии их предков по обеим сторонам - мужчин и женщин. Если их предки не были в полной изоляции, то потомки давно стали антропологически "современными людьми". Если тот же Перри смог раскошелиться на несколько сотен долларов, чтобы сделать ДНК-анализ, и живет и работает в США, то он наверняка такой же хомо сапиенс, как и мы с Вами. Ведь не гаплогруппа определяет антропологию, во всяком случае не одна она.

Но не могу исключить, что в глухих джунглях живут прямые потомки А0, которые бегают по деревьями и питаются выкопанными корнями. Их тоже не глядя "будем считать"? Или все-таки посмотрим?



Автор: Aero 2.10.2012, 22:12

Цитата(aklyosov @ 2.10.2012, 22:59) *
Но не могу исключить, что в глухих джунглях живут прямые потомки А0, которые бегают по деревьями и питаются выкопанными корнями. Их тоже не глядя "будем считать"? Или все-таки посмотрим?


А каким образом - посмотрим? Все таки будем "перебирать" шимпанзе?

Автор: aklyosov 3.10.2012, 1:09

Цитата(Aero @ 2.10.2012, 14:12) *
Цитата(aklyosov @ 2.10.2012, 22:59) *
Но не могу исключить, что в глухих джунглях живут прямые потомки А0, которые бегают по деревьями и питаются выкопанными корнями. Их тоже не глядя "будем считать"? Или все-таки посмотрим?


А каким образом - посмотрим? Все таки будем "перебирать" шимпанзе?


Как каким образом? Есть вполне четкие антропологические критерии Homo sapiens, их суммарно несколько десятков. Шимпанзе никак не является Homo sapiens, ни по одному, наверное, критерию.

Но просто "смотреть" тоже бесполезно. Надо четко сформулировать вопрос, на который ищется ответ.

Автор: bugler 3.10.2012, 7:46

Цитата(aklyosov @ 2.10.2012, 22:59) *
[...
Что значит "будем считать?" Не глядя, просто из соображений чистой политкорректности, или все- таки посмотрим на индивида, как того требует наука и здравый смысл?

Носители А0 наверняка самые разные, и это зависит от антропологии их предков по обеим сторонам - мужчин и женщин. Если их предки не были в полной изоляции, то потомки давно стали антропологически "современными людьми". Если тот же Перри смог раскошелиться на несколько сотен долларов, чтобы сделать ДНК-анализ, и живет и работает в США, то он наверняка такой же хомо сапиенс, как и мы с Вами. Ведь не гаплогруппа определяет антропологию, во всяком случае не одна она.

Но не могу исключить, что в глухих джунглях живут прямые потомки А0, которые бегают по деревьями и питаются выкопанными корнями. Их тоже не глядя "будем считать"? Или все-таки посмотрим?
...


"Будем считать" это означает, что мы не можем сегодня выявить всех потомков А0, в том числе тех, кто, возможно, лазит по деревьям. Даже случайно последние не могут "засветиться", так как у них нет пару сотен долларов под ... smile.gif

А0 - это гаплогруппа, носителями которой являются психологически и анатомически (возможно обладающие крайними расовыми и сапиентными признаками) современные чернокожие жители Африки, отличающиеся от других современных гаплогрупп по набору SNP, и представляющие собой древнюю генеалогическую линию, предположительно никогда не выходившую за пределы Африканского континента вплоть до Нового времени. Где и когда проживал общий предок А0 и альфа гаплогрупп - неизвестно.
Определение может менятсься в свете новых научных даных.

Автор: Aero 3.10.2012, 17:53

Цитата(aklyosov @ 3.10.2012, 2:09) *
Как каким образом? Есть вполне четкие антропологические критерии Homo sapiens, их суммарно несколько десятков. Шимпанзе никак не является Homo sapiens, ни по одному, наверное, критерию.

Но просто "смотреть" тоже бесполезно. Надо четко сформулировать вопрос, на который ищестся ответ.

То есть Вы считаете, что возможно существование современных представителей рода Homo - не сапиенсов? (не найденных, неизвестных?) , т.е Homo - по признакам, не соответствующим критериям сапиенса (возможно не скрещивающихся)? Крайние сапиентные признаки - это все-таки сапиенс.

Возможно, термин - шимпанзе, нужно было тоже убрать в кавычки. Прошу прошения - как-то тоже не очень улавливаю, поэтому переспрашиваю.

Автор: aklyosov 3.10.2012, 19:11

Цитата(bugler @ 2.10.2012, 23:46) *
"Будем считать" это означает, что мы не можем сегодня выявить всех потомков А0, в том числе тех, кто, возможно, лазит по деревьям. Даже случайно последние не могут "засветиться", так как у них нет пару сотен долларов под ... smile.gif


Вопрос даже и не ставится о выявлении ВСЕХ носителей А0 (или ВСЕХ потомков А0). Достаточно и одного как характерный пример. Далее, далеко не все гаплотипы получены коммерческим путем, достаточно и похода в глубь черной Африки и взятия у них образцов слюны или крови, если дадут, конечно. Эта работа постепенно идет. Не нужно забывать, что линия А0 обнаружена всего год назад.

Да и вооще никакой горячки здесь не нужно. Наука развивается своим путем и своими темпами. Со временем будет найдены и несапиенсы, хотя, возможно, и хомо. И гаплогруппа у них, возможно, будет называться уже по-другому. Идет постепенное осмысление материала, выявляются данные, порой совершенно противоречивые. Нормальный ход.

Цитата(bugler @ 2.10.2012, 23:46) *
А0 - это гаплогруппа, носителями которой являются психологически и анатомически (возможно обладающие крайними расовыми и сапиентными признаками) современные чернокожие жители Африки, отличающиеся от других современных гаплогрупп по набору SNP, и представляющие собой древнюю генеалогическую линию, предположительно никогда не выходившую за пределы Африканского континента вплоть до Нового времени. Где и когда проживал общий предок А0 и альфа гаплогрупп - неизвестно.
Определение может менятсься в свете новых научных даных.


В общем годится, хотя А0 в ее нынешнем варианте может оказаться (или уже оказывается) не гаплогруппой, а пакетом разных гаплогрупп от разных общих предков, живших в разные времена. Насчет непременно чернокожих - не знаю. Например, не знаю цвет кожи Перри. Десяток поколений-браков с белыми женщинами - и любой А0 станет светлокожим, как и швед. И что значит "не выходящую за пределы"? Перри-то вышел, может, и столетия назад, а А0 остался.


Автор: bugler 3.10.2012, 21:30

Цитата(aklyosov @ 3.10.2012, 20:11) *
....
Цитата(bugler @ 2.10.2012, 23:46) *
А0 - это гаплогруппа, носителями которой являются психологически и анатомически (возможно обладающие крайними расовыми и сапиентными признаками) современные чернокожие жители Африки, отличающиеся от других современных гаплогрупп по набору SNP, и представляющие собой древнюю генеалогическую линию, предположительно никогда не выходившую за пределы Африканского континента вплоть до Нового времени. Где и когда проживал общий предок А0 и альфа гаплогрупп - неизвестно.
Определение может менятсься в свете новых научных даных.


В общем годится, хотя А0 в ее нынешнем варианте может оказаться (или уже оказывается) не гаплогруппой, а пакетом разных гаплогрупп от разных общих предков, живших в разные времена. Насчет непременно чернокожих - не знаю. Например, не знаю цвет кожи Перри. Десяток поколений-браков с белыми женщинами - и любой А0 станет светлокожим, как и швед. И что значит "не выходящую за пределы"? Перри-то вышел, может, и столетия назад, а А0 остался.


А0 - это совокупность разных гаплогрупп, носителями которой являются психологически и анатомически (возможно обладающие крайними расовыми и сапиентными признаками) современные потомки жителей Африки, отличающиеся от других современных гаплогрупп по набору SNP, и представляющие собой древнии генеалогические линии, предположительно никогда не выходившую за пределы Африканского континента вплоть до Нового времени. Где и когда проживал общий предок А0 и альфа гаплогрупп - неизвестно.
Определение может меняться в свете новых научных даных.


<И что значит "не выходящую за пределы"? Перри-то вышел, может, и столетия назад, а А0 остался.>

Новое время - это хронологический рубеж между средневековьем и новейшим временем. Именно в этот период и стали вывозить в Америку представителей гаплогрупп А0. До этого времени им небыло необходимости оттуда выходить. Им там было хорошо.

Автор: Right & Midfield 4.10.2012, 1:14

Цитата(aklyosov @ 2.10.2012, 13:37) *
попробуйте дать связное изложение от себя. Например, как это сделал выше я.

Мы даже не ставим перед собой таких масштабных задач, мы скорее Ваш "бета-читатель" если угодно.
Однако упрощённо - попробовать можно.

Итак, Вы пишите:
1. Из глубин 6-7 миллионов лет назад, или еще древнее, поднимались несколько генеалогических линий, выживших до настоящего времени (и бесчисленное количество линий, которые не выжили).
2. Две из них - это (а) потомки общего предка современного человека и современного шимпанзе, и (б) потомки чернокожей линии, получившей сейчас условное название А0 (хотя назвать можно как угодно).
3. Возможно, на каком-то этапе это была одна общая генеалогическая линия, объединявшая а/б.


Второй пункт - вызывает бурное отторжение. Мы скорее поверим в то, что на двух разных ветвях произошла мутация M91 (событие очень маловероятное, но хотя бы не противоречащее теории вероятности), чем примем тезис про такие линии (а) и (б). Вы имеете дело не с мутациями STR, SNP и т.д и т.п. - а с хромосомным набором. Изменение хромосомного набора на двух параллельных ветвях с 46 до 48 - это из разряда фантастики. Всё равно что кроманьонец возник бы два раза на разных ветвях.

Таким образом, наша версия более традиционна.
1. Точка входа "от шимпанзе" - была одна, и только одна.
Пускай современные шимпанзе не могут в полной мере прояснить картину снипов, ведь разделение между предками человека и шимпанзе - произошло очень давно, и какими тогда были древние предки современных шимпанзе и древние предки современных людей - мы не знаем. Кроме того, как шимпанзе, так и люди - накапливали ещё и свои раздельные мутации, которые могут картину сбивать.

Но тем не менее, род Homo, датируемый антропологами как ~2000 тлн - не имел никаких соседних линий, и даже жёстче - не имел вообще ни одной "ещё какой-нибудь" линии от шимпанзе. Любые линии внутри рода Homo (как сапиенсы, так и не сапиенсы) - к линиям шимпанзе отношения не имеют, кроме как через единственную "точку входа".

2. Реликтовая линия A0 (в нотации ISOGG 2012) - несомненно древняя. Но сколь древней она бы не была - это обычный сапиенс. И то - чудом сохранившийся в Африке. Всех несапиенсов, т.е. всех людей других видов - зачистил кроманьонец.
3. Не "возможно", но "именно". У всех ныне существующих людей - была одна общая линия до одного общего предка. Общий предок - широко известный Y-Adam.


Далее, Вы пишите:
Эта линия разошлась на три генеалогические линии. Одна, "А0", отошла первой (или не отошла, а шла параллельно), и она была негроидной, чернокожей. Она ушла в Африку или всегда была в Африке. Другая линия, нечернокожая, разошлась 300-500 тысяч лет назад, на неандертальцев и на будущих Homo sapiens. Неандертальцы были светлокожие и рыжие (хотя могли быть и шатены и какие угодно), как и предки современного человека.

1. Ремарка: нам всё равно, какой цвет кожи был у первых людей сотни тысяч лет назад. Мы на этом вопросе - акцента не делали бы.
2. По сути. Неандертальцы - это другой вид. Да, это тоже люди, причём не такие уж и отсталые, но далеко не тоже самое, что и сапиенсы A0 (не в смысле "продвинутости" - а в смысле "инаковости"). Все три линии (A0, и Ваши альфа-группа и бета-группа) - это сапиенсы. Неважно, плохие или хорошие, но похожие друг на друга, а не на другие виды Homo.

Нашу точку зрения по датировкам - мы высказали в первом комментарии на Вашу концепцию.
Да, общий предок Идалту и Адама (условно Первый сапиенс) - мог возникнуть раньше, чем отделились неандертальцы (которые могли отделиться от кого-то из потомков Первого сапиенса, в конце концов - маркеры - это только "паспорт", а не геном, фенотип и т.п.).
Но во-первых - это касается не всех ныне живущих сапиенсов, а включает ещё и Идалту (не оставившего потомства среди ныне живущих).
Во-вторых - Первый сапиенс мог возникнуть и позже точки отделения неандертальцев.
В третьих, и в главных - линия A0, восходящая к Y-Адаму, а не к Первому сапиенсу - даже теоретически не может перепрыгнуть за точку расхождения с неандертальцами, какой бы эта точка не оказалась. На наш взгляд (мы ориентируемся на расхождение mt-DNA) - те кто впоследствии стали неандертальцами - отделились ~300 тлн.


Далее, Вы пишите:
1. Будущие H. sapiens вышли на альфа-гаплогруппу, от которой отошла линия, которая ушла в Африку между 160 и 120-100 тысяч лет назад.
2. Там они смешались с чернокожими и сами стали чернокожими. Это - гаплогруппа А (в разных вариантах).
3. Остальные продолжали быть неафриканцами, и образовали бета-гаплогруппу примерно 64 тысячи лет назад. Возможно, их предков (живших от 160 до 60 тыс лет назад) истребил вулкан Тоба, возможно, они вымерли по другим причинам.

1. То есть как "будущие"? Сапиенсом (подвидом) - официально признан тот же эфиопский Идалту, который датируется ~200 тлн. Может быть мы Вас неправильно поняли?
2. Ну и естественно, даже если альфа-группа не родилась в Африке, а пришла туда, и обнаружила группу A0, то смешались они тоже с сапиенсами.
3. Это самый интересный вопрос, на который нет однозначного ответа. Ну то есть - про образование гаплогруппы BT и далее - это конечно так. А вот где жили предки BT - вопрос.

Мы никуда не денемся от связи между A0, альфа и бета группами. Она есть.
Для науки интересно, кто всё-таки был root, чьи SNP были у Y-Адама.
Да и для более точных датировок TMRCA - полезно знать взаиморасположение ключевых ветвей.
Но, даже если будет показано, что предки группы BT занимают подчинённое положение наследников ДНК маркеров - предки мужчин группы BT (равно как и предки женщин группы MN) не могли жить в Африке на момент катастрофы Тоба (73 тлн +/-) :
- если бы предки группы BT жили на тот момент в Африке, то прихватили с собой из Африки в Евразию - и другие африканские группы, чего не наблюдалось.
- если бы предки группы BT жили на тот момент в Африке, то и там оставили бы потомков, чего тоже не наблюдалось. Лишь только "сильно потом" группа B нашла дорогу в Африку.

Ну и разумеется - речь идёт не о самой группе BT, а о её предках. Это значит, что возникнуть они могли почти где угодно (Ближний Восток, Кавказ, Иран - т.е. в местах где не было явной доминации неандертальцев или денисовцев в период между образованием альфа-группы и катастрофой Тоба). Африка - лишь одна из гипотез, и тоже самое - верно и для Y-Адама, и для Первого сапиенса, и для общего предка сапиенсов и кроманьонцев, и для общего предка сапиенсов/кроманьонцев/денисовцев.
Гадать, где происходили возникновения наших ключевых предков сотни тысяч лет назад - мы не видим большого смысла. Ибо это не имеет никакого значения в проблематике возникновения людей современного типа, кроманьонцев. Повторимся: ДНК-генеалогия скорректировала представления об Y-Адаме с первичных 70 тлн, до 200 тлн как мимнимум, и тем самым - сняла значительную долю напряжённости в противостоянии африканской/неафриканской гипотез.

Автор: bugler 4.10.2012, 4:38

Цитата(Right & Midfield @ 4.10.2012, 2:14) *
... Вы имеете дело не с мутациями STR, SNP и т.д и т.п. - а с хромосомным набором. Изменение хромосомного набора на двух параллельных ветвях с 46 до 48 - это из разряда фантастики. Всё равно что кроманьонец возник бы два раза на разных ветвях.
....


Немного странный поворот. Хотелось бы получить более точное разъяснение. ДНК-генеалогия по определению имеет дело именно с STR и SNP мутациями. Поэтому и идёт речь о генеалогических линиях, а не о линиях антропогенеза. Гаплотипы и гаплогруппы не дают ответа на вопрос был или не был предок человеком. И всегда существует момент перехода от животного к человеку, при этом гаплотип и гаплогруппа не обязательно должны меняться. Только длительная специализация приводит к расхождению вида на два новых вида.

Автор: Люда 4.10.2012, 7:04

Цитата
(Right & Midfield @ 4.10.2012, 2:14) *
... Вы имеете дело не с мутациями STR, SNP и т.д и т.п. - а с хромосомным набором. Изменение хромосомного набора на двух параллельных ветвях с 46 до 48 - это из разряда фантастики. Всё равно что кроманьонец возник бы два раза на разных ветвях.

Это абсолютно верно (бегу на работу).
bugler
Цитата
ДНК-генеалогия по определению имеет дело именно с STR и SNP мутациями.

Это так, но чтобы передать свою У-хромосому, нужна возможность скрещевания. Одинаковый набор хромосом -необходимое условие. Поэтому и другие Homo (неандерт.-денис.) должны были иметь тот же набор хр. И А0, конечно.

Автор: В.Юрковец 4.10.2012, 8:59

Цитата(Right & Midfield @ 4.10.2012, 2:14) *
Цитата(aklyosov @ 2.10.2012, 13:37) *
попробуйте дать связное изложение от себя. Например, как это сделал выше я.

Мы даже не ставим перед собой таких масштабных задач, мы скорее Ваш "бета-читатель" если угодно.
Однако упрощённо - попробовать можно.

Итак, Вы пишите:
1. Из глубин 6-7 миллионов лет назад, или еще древнее, поднимались несколько генеалогических линий, выживших до настоящего времени (и бесчисленное количество линий, которые не выжили).
2. Две из них - это (а) потомки общего предка современного человека и современного шимпанзе, и (б) потомки чернокожей линии, получившей сейчас условное название А0 (хотя назвать можно как угодно).
3. Возможно, на каком-то этапе это была одна общая генеалогическая линия, объединявшая а/б.


Второй пункт - вызывает бурное отторжение. Мы скорее поверим в то, что на двух разных ветвях произошла мутация M91 (событие очень маловероятное, но хотя бы не противоречащее теории вероятности), чем примем тезис про такие линии (а) и (б). Вы имеете дело не с мутациями STR, SNP и т.д и т.п. - а с хромосомным набором. Изменение хромосомного набора на двух параллельных ветвях с 46 до 48 - это из разряда фантастики. Всё равно что кроманьонец возник бы два раза на разных ветвях.
...

Если поменять не "точку входа", а линию, то противоречие исчезает - отделился не человек от шимпанзе, а шимпанзе от человека.

Автор: Славер 4.10.2012, 10:12

Цитата(Right & Midfield @ 4.10.2012, 2:14) *
Повторимся: ДНК-генеалогия скорректировала представления об Y-Адаме с первичных 70 тлн, до 200 тлн как мимнимум, и тем самым - сняла значительную долю напряжённости в противостоянии африканской/неафриканской гипотез.

Звучит как признание "поражения", но только на том рубеже где сопротивление бесполезно.

Автор: aklyosov 4.10.2012, 12:48

Цитата(Aero @ 3.10.2012, 9:53) *
То есть Вы считаете, что возможно существование современных представителей рода Homo - не сапиенсов? (не найденных, неизвестных?) , т.е Homo - по признакам, не соответствующим критериям сапиенса (возможно не скрещивающихся)? Крайние сапиентные признаки - это все-таки сапиенс.


Любая классификация - это дань простоте в ущерб истине.

Нет никакого четкого консенсуса, что такое "сапиенс", есть целое облако признаков, которые порой противоречат друг другу. Есть много спорных вариантов отнесения древних костей к "сапиенс" или "не совсем сапиенс", или "не сапиенс". То же и о скрещивании. Я бы не стал оперировать голыми схемами в таких спорных вопросах.

То ж и о видах. Виды не скрещиваются, но новые виды появляются. С кем они, новые, скрещиваются?

Автор: aklyosov 4.10.2012, 13:02

Цитата(Right & Midfield @ 3.10.2012, 17:14) *
Цитата(aklyosov @ 2.10.2012, 13:37) *
попробуйте дать связное изложение от себя. Например, как это сделал выше я.

>...Однако упрощённо - попробовать можно.
>Второй пункт - вызывает бурное отторжение...
>Мы скорее поверим в то...
>...это из разряда фантастики.
>... наша версия более традиционна.
>... как шимпанзе, так и люди - накапливали ещё и свои раздельные мутации, которые могут картину сбивать.
>...Но тем не менее, род Homo, датируемый антропологами как ~2000 тлн - не имел никаких соседних линий...
>...Всех несапиенсов, т.е. всех людей других видов - зачистил кроманьонец.
>.. У всех ныне существующих людей - была одна общая линия до одного общего предка. Общий предок - широко известный Y-Adam.
>...Мы на этом вопросе - акцента не делали бы.
>... это сапиенсы. Неважно, плохие или хорошие...
>... мы высказали в первом комментарии на Вашу концепцию.
>...Может быть мы Вас неправильно поняли?
>...Мы никуда не денемся от связи между A0, альфа и бета группами. Она есть.
>...Африка - лишь одна из гипотез, и тоже самое - верно и для Y-Адама, и для Первого сапиенса, и для общего предка сапиенсов и кроманьонцев, и для общего предка сапиенсов/кроманьонцев/денисовцев.


Вам было предложено дать связное изложение своей концепции, Вы же, в своем стиле, тут же скатились в цепляние за то, что далеко не всегда поняли. Это что, процитированное выше, связная концепция? Это не связная концепция, а бессвязный поток сознания. Вы ничего своего не предлагаете, а пытаетеь "критиковать". Легкий путь, но совершенно бесплодный.

Автор: aklyosov 4.10.2012, 13:08

Цитата(Right & Midfield @ 3.10.2012, 17:14) *
Итак, Вы пишите:
1. Из глубин 6-7 миллионов лет назад, или еще древнее, поднимались несколько генеалогических линий, выживших до настоящего времени (и бесчисленное количество линий, которые не выжили).
2. Две из них - это (а) потомки общего предка современного человека и современного шимпанзе, и (б) потомки чернокожей линии, получившей сейчас условное название А0 (хотя назвать можно как угодно).
3. Возможно, на каком-то этапе это была одна общая генеалогическая линия, объединявшая а/б.


Второй пункт - вызывает бурное отторжение. ..Таким образом, наша версия более традиционна...Точка входа "от шимпанзе" - была одна, и только одна.


Отторгайте на здоровье. Вы что, не видите третий пункт?

В этом и бесплодность Вашего "подхода". Вы выхватываете одну позицию и на нее наскакиваете, хотя рядом была альтернатива.

Автор: Люда 4.10.2012, 13:31

Мне кажется, нормальное обсуждение. Right & Midfield обратили внимание, что пункт №2 из предложенных 3х, менее реален. Действительно так. Хотя, как спекуляция - может у неандертальцев и денисовцев был набор хромосом, отличающийся от сапиенса, поэтому и репродуктивного потомства нет? Не знаю, распределен уже прочитанный у них геном по хромосомам или еще ввиде short-gun последовательности?
В остальном, я со своими взглядами особенных противоречий не вижу. Мне только совершенно непонятно, что они предлагали по построению Древа? И как может быть неинтересна филогения А0?
А так, конечно, однозначных ответов по каждому пункту нет.

Автор: Right & Midfield 4.10.2012, 13:34

Цитата(В.Юрковец @ 4.10.2012, 9:59) *
Если поменять не "точку входа", а линию, то противоречие исчезает - отделился не человек от шимпанзе, а шимпанзе от человека.

Если бы у орангутана, гориллы и человека - было 46, а у шимпанзе - 48,
то да, так можно было бы предположить.
Но у орангутана, гориллы и шимпанзе - 48, это у человека 46.
Если предположить, что человек всё равно главнее, и все приматы произошли от человеческих предков,
то тогда отделяясь - они творили одинаковое чудо каждый раз, т.е. каждый раз меняя 46 на 48 сначала у орангутанов, потом у горилл, потом у шимпанзе.

Поэтому мы более традиционны: у гоминид 48 и это было главной линией до возникновения человека, начиная с периода 15-20 млн лет назад.
Затем у человека, а значит у всех людей всех видов, и уж тем более подвидов - стало 46. Один раз и навсегда.

Цитата(Славер @ 4.10.2012, 11:12) *
Звучит как признание "поражения", но только на том рубеже где сопротивление бесполезно.

Нам будет не зазорно признать своё поражение, посыпать голову пеплом и съесть шляпу - мы же не утверждали, что претендент только один; ровно наоборот - постоянно говорили, что претендентов несколько.

Автор: Люда 4.10.2012, 15:08

А в чем "поражение"? Африканская-неафриканская гипотеза? По-моему, здесь никто не настаивает, что неафрика. Возражают только, что неприменно Африка.

Автор: Right & Midfield 4.10.2012, 16:21

Цитата(Люда @ 4.10.2012, 14:31) *
И как может быть неинтересна филогения А0?

Филогения - безусловно интересна.
Не интересно - полгода искать для Perry - место ниже root на деревьях ISOGG 2012.

Цитата(Люда @ 4.10.2012, 16:08) *
1. По-моему, здесь никто не настаивает, что неафрика. Возражают только, что неприменно Африка.
2. А в чем "поражение"?

1. Это как раз наша позиция в том числе. Т.е. "поражение" не в этом вопросе.
2. В вопросе "первородства" группы BT.

Цитата(Люда @ 4.10.2012, 14:31) *
Мне только совершенно непонятно, что они предлагали по построению Древа?

1. Мы считаем группу BT основным претендентом на помещение в root, т.е. на то что бы Y-Адам обладал таким же сочетанием ключевых снипов; в первую очередь потому что M91=9T.
Однако мы признаём, что это только один из возможных претендентов. Ведь возвратная мутация - теоретически возможна (древние шимпанзе 9T - первые сапиенсы 8T - кроманьонцы опять 9T), да и Cruciani предложил ещё один способ - нашёл "удобных" современных шимпанзе с 8T.
Таким образом, возможно следующее развитие событий:

Первый вариант.
- древние шимпанзе 8T (потомков которых мы находим сейчас с 8T);
- мутация 9T, затем разделение на сапиенсов и шимпанзе (потомков которых мы находим сейчас с 9T);
- обратная мутация 8T у части сапиенсов.

Второй вариант:
- древние шимпанзе 9T (потомков которых мы находим сейчас с 9T);
- мутация 8T, затем разделение на сапиенсов и шимпанзе (потомков которых мы находим сейчас с 8T);
- обратная мутация 9T у кроманьонцев.

Разумеется - Cruciani прав в том, что снип "эволюционно нестабилен", но это не значит, что события развивались обязательно по второму варианту, а первый - надо отбросить. Могло быть и наоборот.

2. Та работа, в которой участвовали и Вы - предлагает точки входа "от шимпанзе" - по второму варианту,
что исключает группу BT из претендентов (а заодно и группу A2/A3). В претендентах на роль Адама остаётся две группы:
либо группа A1a (в старой нотации),
либо кто-то из группы A1*/A1b (т.е. или Perry которые A1* в старой нотации, или Boon/Dorsey/Jones которые A1b в старой нотации).

На первый взгляд - глобальных противоречий мы не видим. Более пристально - можно будет посмотреть только после оформления гипотезы - в научных формулировках, в статье. Т.е. мы снимаем шляпу, но пока ещё не едим её smile.gif

3. По нашему мнению - данной гипотезе вовсе не нужны дополнительные "навороты" в виде залезания в совершенно ненужные дебри генетики кариотипов. Кроме того что это не дело ДНК-генеалогии, можно ещё и вред нанести собственной гипотезе, подставив её под огонь критики,
причём по вторичному по сути вопросу,
ведь первичный то вопрос (набор снипов Y-Адама) - для ДНК-генеалогии гораздо важнее.

Автор: казак 4.10.2012, 16:34

Цитата(Люда @ 4.10.2012, 8:04) *
Цитата
(Right & Midfield @ 4.10.2012, 2:14) *
... Вы имеете дело не с мутациями STR, SNP и т.д и т.п. - а с хромосомным набором. Изменение хромосомного набора на двух параллельных ветвях с 46 до 48 - это из разряда фантастики. Всё равно что кроманьонец возник бы два раза на разных ветвях.

Это абсолютно верно (бегу на работу).
bugler
Цитата
ДНК-генеалогия по определению имеет дело именно с STR и SNP мутациями.

Это так, но чтобы передать свою У-хромосому, нужна возможность скрещевания. Одинаковый набор хромосом -необходимое условие. Поэтому и другие Homo (неандерт.-денис.) должны были иметь тот же набор хр. И А0, конечно.

Из разряда фантастики? Так посмотрите на фантастику в природе с примером мула, у которого 63 хромосомы, а у родителей - осла 62, у лошади 64 хромосомы. Да, у мула нет потомства, но кто практиковал на хомо? Кроме того, кроманьонец и был на разных ветвях и пример с ним не показатель - не исключен вариант кроманьодности вообще третьей стороны, передавшей существующим ветвям признаки кроманьодности ОДНОВРЕМЕННО.


Мы исходим из теории Дарвина, относящей единственную линию развития в очень отдаленные времена. А может, их было несколько? Попробуйте ка вырастить сладкий перец посреди поля перца горького...Да не один миллион лет...


Автор: bugler 4.10.2012, 17:09

Цитата(Люда @ 4.10.2012, 8:04) *
...
bugler
Цитата
ДНК-генеалогия по определению имеет дело именно с STR и SNP мутациями.

Это так, но чтобы передать свою У-хромосому, нужна возможность скрещевания. Одинаковый набор хромосом -необходимое условие. Поэтому и другие Homo (неандерт.-денис.) должны были иметь тот же набор хр. И А0, конечно.


aklyosov
>То ж и о видах. Виды не скрещиваются, но новые виды появляются. С кем они, новые, скрещиваются?

Вот и меня это смущает. Потому что получается жил некий примат с приматкой, бац и шимпанзе получилось. Ещё пожили - бац и кроманьонец. А шимпанзе кроманьонцу не брат...Наверняка образование нового вида это сложный и длительный процесс, где намешивается куча тупиковых вариантов. И только после этого начинает работать хромосомная защита "свой-чужой".

Автор: Igor1961 4.10.2012, 17:52

Что-то дискуссия стала приобретать какой-то хаотический характер. Честно говоря, никак не могу поймать ускользающие за словами мысли.

Предлагаю вернуться на твердую почву фактов. Поскольку участники, похоже, вкладывают разный смысл в аббревиатуру А0, хотел бы напомнить, что это не какая-то абстракция, а вполне реальные люди, причем их не так уж мало в коммерческих базах данных. Скажем, гаплогруппы N1b и Q1a2 представлены меньшим количеством гаплотипов аналогичной длины. Вот как выглядит их дерево в 34-маркерном формате, общем для FTDNA и SMGF,

http://www.radikal.ru

Красным помечены (афро)американцы из США, фиолетовым - жители Кариб, черным - африканцы. Основная их масса приходится на Западную провинцию Камеруна (кружки), плюс несколько представителе Ганы (ромбы).

Ветвь, к которой относится Перри (вверху), стоит особняком во всех форматах. Картинка не отображает истинный масштаб времени, на которое она отстоит от остальных. Оценки по 22-маркерной панели дают порядка 200 тыс. лет до общего предка этих камерунцев из народности Бамилеке с альфа-гаплогруппой. Это очень давно, но все же после того, как разошлись пути современных людей и неандертальцев. Сама по себе эта ветвь довольно однородна и молода - 700+/-200 лет до общего предка. Это времена, когда по Западной Африке прокатывались волны нашествий воинственных племен из зоны Сахеля и даже из Марокко, что создавали кочевые империи на манер тюркских или монгольских. Народы приходили в движение, так что наверняка при более тщательном анализе в регионе наверняка обнаружатся и другие линии того же возраста из других гаплогрупп.

Остальные гаплотипы достаточно надежно сходятся к общему предку, жившему около 55 тыс. лет назад, как уже писал раньше. Ветвь, отмеченная синим, имеет возраст около 900 лет. То есть, это примерно та же эпоха, что и в истории "клана Перри". А вот "красная" ветвь оказалась существенно старше - 2800+/-400 лет назад. Причем она единственная из всех "засветилась" в судебно-медицинской базе данных YHRD. На гаплогруппном проекте эту супер-ветвь от Simms'a до Dorsey поделили на A0a и A0b, но насколько это деление отображает ее реальную структуру, неясно.

Общий предок этой ветви с альфа-гаплогруппой попадает примерно на то же время, что в случае с ветвью Перри, но их взаимное расположение на общем дереве пока неясно.

Автор: В.Юрковец 4.10.2012, 22:55

Цитата(Right & Midfield @ 4.10.2012, 14:34) *
Цитата(В.Юрковец @ 4.10.2012, 9:59) *
Если поменять не "точку входа", а линию, то противоречие исчезает - отделился не человек от шимпанзе, а шимпанзе от человека.

Если бы у орангутана, гориллы и человека - было 46, а у шимпанзе - 48,
то да, так можно было бы предположить.
Но у орангутана, гориллы и шимпанзе - 48, это у человека 46.
Если предположить, что человек всё равно главнее, и все приматы произошли от человеческих предков,
то тогда отделяясь - они творили одинаковое чудо каждый раз, т.е. каждый раз меняя 46 на 48 сначала у орангутанов, потом у горилл, потом у шимпанзе.

Поэтому мы более традиционны: у гоминид 48 и это было главной линией до возникновения человека, начиная с периода 15-20 млн лет назад.
Затем у человека, а значит у всех людей всех видов, и уж тем более подвидов - стало 46. Один раз и навсегда.

Если понгид объединить в одну ветвь (а это так и есть), то и эта проблема исчезает. Человек разошёлся с понгидами 15-20 миллионов лет назад и дальше каждая ветвь пошла своим путём.

Автор: Люда 5.10.2012, 11:17

Igor1961

Цитата
гаплотипы достаточно надежно сходятся к общему предку, жившему около 55 тыс. лет назад

Это о А0. Вы приводили схему, где вместе с А0 были и разные А1. А их общий предок просчитывается?
Right & Midfield Все-таки Древо Вы построить не можете (причем, бросая тень подозрения на Cruciani). Root у вас то Перри, то ВТ, то любая другая группа. При такой позиции, конечно, шляпу есть не придется. М91 обсуждать, конечно, можно. Но почему "в первую очередь потому что M91=9T".
M91, мне кажется, вообще надо отбросить, если он "скачет". И почему он ключевой? Целаю группа снипов, отличающая ВТ группу.

Автор: Igor1961 5.10.2012, 12:19

Цитата(Люда @ 5.10.2012, 17:17) *
Igor1961
Цитата
гаплотипы достаточно надежно сходятся к общему предку, жившему около 55 тыс. лет назад

Это о А0. Вы приводили схему, где вместе с А0 были и разные А1. А их общий предок просчитывается?

Просчитывается, и схема, на которую давал ссылку в сообщении № 52 этой темы, это хорошо показывает. "Ганско-камерунская" ветвь А0 дает общего предка с А1 (что то же самое, что альфа-гаплогруппа) около 200 тыс. лет назад. Положение ветви Перри менее определенно из-за того, что от нее пока имеется единичный гаплотип в 22-маркерном медленном формате, а его снипы до сих пор недоступны. Ясно лишь, что она уходит далеко и не принадлежит ни к А1, ни к охарактеризованной выше древней африканской ветви. Гамма- или дельта-гаплогруппа, так сказать, если продолжить аналогии. unsure.gif

Цитата(Люда @ 5.10.2012, 17:17) *
M91, мне кажется, вообще надо отбросить, если он "скачет".

Пора, потому что не так давно у нескольких носителей гаплогруппы I1 нашли 10 тиминов в том же локусе. По определению, для филогении используются только локусы, в которых наблюдается только 2 значения нуклеотидов (binary polymorphism). М91 дал три - 8Т, 9Т и 10Т, причем еще с возвратами.

Цитата(Люда @ 5.10.2012, 17:17) *
И почему он ключевой? Целаю группа снипов, отличающая ВТ группу.

Наверное, по той же логике, как у жителей планеты Плюк:

- Где там твоя цапа?
- Гайка такая ржавая.
- Тут все гайки ржавые.
- А эта самая ржавая!

Автор: Боромир 6.10.2012, 1:31

Цитата(aklyosov @ 1.10.2012, 7:00) *
...
2. Нет никаких четких доказательств о том, что в нас есть якобы "гены неандертальца". Публикации в "академической литературе" идут чехардой, поочередно опровергая друг друга.
...

Два современных лидера в сиквенировании древних геномов Сванте Паабо из Макс Планка и Давид Райх из Гарварда в своей новой статье утверждают, что обмен генами между современным человеком и неандертальцем вероятно произошёл 37,000–86,000 лтн (скорее всего 47,000–65,000 лтн) после выхода человека из Африки. smile.gif http://www.plosgenetics.org/article/info%3Adoi%2F10.1371%2Fjournal.pgen.1002947 в открытом доступе.

Sankararaman S, Patterson N, Li H, Pääbo S, Reich D (2012) The Date of Interbreeding between Neandertals and Modern Humans. PLoS Genet 8(10): e1002947. doi:10.1371/journal.pgen.1002947

Автор: bugler 6.10.2012, 5:51

Цитата(Боромир @ 6.10.2012, 2:31) *
Цитата(aklyosov @ 1.10.2012, 7:00) *
...
2. Нет никаких четких доказательств о том, что в нас есть якобы "гены неандертальца". Публикации в "академической литературе" идут чехардой, поочередно опровергая друг друга.
...

Два современных лидера в сиквенировании древних геномов Сванте Паабо из Макс Планка и Давид Райх из Гарварда в своей новой статье утверждают, что обмен генами между современным человеком и неандертальцем вероятно произошёл 37,000–86,000 лтн (скорее всего 47,000–65,000 лтн) после выхода человека из Африки. smile.gif http://www.plosgenetics.org/article/info%3Adoi%2F10.1371%2Fjournal.pgen.1002947 в открытом доступе.

Sankararaman S, Patterson N, Li H, Pääbo S, Reich D (2012) The Date of Interbreeding between Neandertals and Modern Humans. PLoS Genet 8(10): e1002947. doi:10.1371/journal.pgen.1002947


В Африке нет ни одной находки костей "анатомически современного человека" старше 40000 тлн. Всё что старше - одно выпячивают, о другом умалчивают. Последние находки неандертальцев 35000-27000 тлн. Так что скорее это бета-гаплогруппа нагрешила. И где-то на стыке ближневосточной популяции архаичных хомо сапиенс и классических неандертальцев Европы ( Балканы, Малая Азия или Русская Равнина). Есть даже версия, что хомо сапинс и есть продукт такого скрещивания. И эта версия позволяет объяснить многие вопросы. Но из Африки не выходил точно. Африка ловушка , которая остановила прогресс (в нашем понимании) тех, кто туда попал. BBC очень хорошее название дала своему фильму -"Зачарованая Африка" ( или так перевели на русский)
За статью спасибо. Жаль на английском. Прийдётся лоб морщить...

Автор: Right & Midfield 9.10.2012, 10:46

Цитата(Люда @ 5.10.2012, 12:17) *
Все-таки Древо Вы построить не можете. Root у вас то Перри, то ВТ, то любая другая группа.

Не считаем возможным. Дерево лет десять было неукоренено, и у нас пока нет доказательств, что его можно укоренить, произвольно выдвинув в корень - одну из групп-претендентов. Надеемся, что для всех очевидно: альфа-группа (мужские A1, A2, A3 в нотации 2011 и соответствующие женские L1-L7), бета-группа (мужские BT и соответствующие женские MN) и нуль-группа (мужская A0 и соответствующая женская L0) - это три дошедшие до нас веточки некогда огромного дерева сапиенсов. Каждая из групп - не такая уж древняя сама по себе, но их общий предок - очень древний. Мы не знаем - где он жил; мы не знаем - как складывались взаимоотношения предок-потомок между ПРЕДКАМИ групп тогда, в период примерно ~200 тлн; мы не знаем - какой набор снипов был у Y-Адама (а у mt-Евы, в вопросе "первородства" одной из групп - ещё более "условная" картина).

Цитата(Люда @ 5.10.2012, 12:17) *
М91 обсуждать, конечно, можно.
1. Но почему "в первую очередь потому что M91=9T".
2. M91, мне кажется, вообще надо отбросить, если он "скачет".

1. Потому что это "метка". Обращает наше внимание на то, что у Y-Адама могло быть как 8Т так и 9Т, и таким образом - "метка" показывает нам, что вариант был не один.
2. Как "железный" аргумент - использовать конечно нельзя. Ну например: если мы выдвинем группу BT в root только лишь на основании одного аргумента M91=9T, то этого недостаточно для доказательства.

Цитата(Люда @ 5.10.2012, 12:17) *
И почему он ключевой? Целаю группа снипов, отличающая ВТ группу.

Повторимся: у нас с Вами одинаковое понимание ключевых снипов.
M91 ничем не лучше и не хуже например M42 - точно также отличает группу BT от xBT.

Цитата(Люда @ 5.10.2012, 12:17) *
причем, бросая тень подозрения на Cruciani

1. Ну ведь он же вроде бы учёный! Обязан учитывать разные варианты.
А так - получается, что он отбросил один из вариантов.
Если факты противоречат теории - тем хуже для фактов?

Снип M91 нестабилен в любом случае! И при выборе варианта возвратной мутации из 8T в 9T, и наоборот.
Но это не повод отбрасывать один из возможных вариантов развития событий. Тем более что второй вариант - ничем не лучше и не хуже: если возвратная мутация шла из 9T в 8T, то снип нестабилен точно также.

2. Отсюда простой вывод: Cruciani использовал "псевдоаргумент шимпанзе", для того чтобы отбросить "неудобный" вариант. Однако отметим, что не более того. Т.е. он всё-таки не стал менять "точку опоры" - отказался от сравнения шимпанзе с людьми - ещё и для доказательства "удобного" варианта. Cruciani пошёл другим путём - предложил свои V-SNP.

Цитата(Люда @ 5.10.2012, 12:17) *
При такой позиции, конечно, шляпу есть не придется.

1. На текущем варианте дерева FTDNA 2012 - у групп BT, B, CT - убраны ВСЕ снипы серии V.
Не из ревности американцев к итальянцам - ибо на других ветках снипы серии V - активно используются.
Конечно - скорее всего снипы убраны просто "до выяснения обстоятельств".
Но мало ли - может грядёт новый уровень знаний об Y-Адаме, тогда да - если группа BT "победит", то у вышеуказанных групп не поменяется аллель (разумеется), но поменяется "плюс/минус".

2. Нам бы не хотелось быть заранее предвзятыми к чужому труду, но мы сильно недоумеваем, когда читаем фразы типа: "Пока снипы Перри не будут опубликованы в полном варианте (с серией V, как минимум), нам остается только гадать, из каких мотивов исходит Томас, присваивая предковые нуклеотиды в том или ином фрагменте.";
или типа: "Без снипов Перри пока нет возможности определить, к какой из 3-х теоретически возможных частей дерева прикрепляется ветвь, соединяющая нас с шимпанзе.";
или типа: "информация по Перри пока однобокая".

Ведь мы же ещё в феврале говорили про то что Perry=root на деревьях 2012, что у Perry минусы во всех снипах...
То есть, если нужны V-SNP Perry, то пожалуйста: читаем работу Cruciani, заходим в приложение Table S2, забираем все предковые аллели у всех V-SNP - это аллели Perry. Ну ничего же сложного!
После того как программа Cruciani попала пальцем в небо и поставила бывшую группу A1* в root, сам Cruciani конечно же не плюсики/минусики расставил у своих снипов, а значения предковых/потомковых аллелей. Это же ведь на тот момент были новые снипы, ценность для науки - их надо было не просто "раскидать по веткам", но и описать, что и сделано в Table S2.
Там же - Вы можете забрать и значения потомковых аллелей. То есть: Вы изначально могли, и теперь уж точно можете (если разобрались) - провести с V-снипами Perry - аналогичную работу, такую же, которую Вы уже провели со снипами серии L. Таким образом, Вы можете усовершенствовать свою гипотезу: уточнить "точку входа от шимпанзе" с трёх до одной единственной.

Для иллюстрации - выкладываем дерево FTDNA 2012 в нашем представлении (ничего сверхъестественного - просто поудобнее, и ещё фамилии указаны). В крайней левой колонке - три цифры (1,2,3) которые соответствуют Вашим "точкам входа от шимпанзе":
1 - верхней, 2 - средней, 3 - нижней точке.
Пароля на файл - нет.
http://rusfolder.com/33031289

Удачи Вам! Может ещё успеете до выхода ноябрьского номера журнала...

3. Но это ещё не всё. Так как Perry=root на деревьях 2012, то не только снипы V-серии у него все по минусу, но и вообще все известные ранее снипы всех серий - тоже по минусу. Если Вам для своей гипотезы - захочется сравнить Perry, шимпанзе и людей - не только по снипам серий L и V, то Вы можете взять вообще любой снип, обнаруженный до появления Perry на проекте FTDNA - у Perry будет предковое значение аллели, а у тех снипов, что уже были ранее "раскиданы" по веткам гаплогрупп - будет потомковое значение аллели.

4. Как только FTDNA поняли, что господину Cruciani просто не повезло, потому что у него не было образца ДНК бывшей группы A1* - то тут же закрыли информацию по Perry. И вовсе не из-за того, что исследует Perry на все "тыщи" старых снипов. В этом нет смысла, ибо достаточно исследовать V166- и V168-, чтобы понять простейшую комбинаторику: раз Perry не принадлежит ни A0 ни A1 (в нотации деревьев 2012), то Perry=root, а значит и по всем остальным известным к тому моменту снипам - у него тоже будут все минусы, т.е. предковые значения аллелей. А это значит, что его гораздо правильней - исследовать на НОВЫЕ снипы! Что мы и наблюдаем: новые снипы серии L - повалили как из рога изобилия, и пока Thomas Krahn не выжмет ДНК Perry до последнего нуклеотида - инфу не откроет. Это бизнес - ничего личного. Конечно - немножко обидно тем, кто жертвовал финансы на этот проект (например пан Stanislaw) и полгода чего-то ждёт от коммерческой фирмы FTDNA... но тем не менее - польза-то для науки всё равно есть, ведь новые снипы серии L - помогут всем исследователям.

Автор: Right & Midfield 9.10.2012, 20:23

Цитата(Боромир @ 6.10.2012, 2:31) *
что обмен генами между современным человеком и неандертальцем вероятно произошёл 37,000–86,000 лтн (скорее всего 47,000–65,000 лтн) после выхода человека из Африки. smile.gif

1. Что нам всегда нравилось у Svante Paabo, так это здравый подход к уменьшению датировок.
Пусть и не сразу, но он тоже приходит к мысли о том, что "возраст поколения" - надо уже как-то учитывать поточнее.
2. Нам показалась интересной вот эта статья про денисовцев:
http://www.pnas.org/content/early/2011/10/24/1108181108.abstract

Покойный Старостин всё удивлялся - откуда у папуасов столько разных и древних языков.
Однако если контакт между папуасами и денисовцами действительно был - то вполне вероятна не только частичная передача генов, но и частичная передача языка, что по-видимому и привело к столь великому разнообразию языков в Новой Гвинее.

Цитата(казак @ 4.10.2012, 17:34) *
Из разряда фантастики? Так посмотрите на фантастику в природе с примером мула, у которого 63 хромосомы, а у родителей - осла 62, у лошади 64 хромосомы. Да, у мула нет потомства, но кто практиковал на хомо?

Эволюция практиковала.
Человек, обладающий не промежуточным набором из 47 хромосом - есть не "промежуточный" продукт между наборами из 46 и 48 хромосом, а "конечный" продукт с набором из 46 хромосом. Причём довольно давно оформившийся как вид, и разумеется A0 включительно.

Цитата(казак @ 4.10.2012, 17:34) *
Кроме того, кроманьонец и был на разных ветвях и пример с ним не показатель - не исключен вариант кроманьодности вообще третьей стороны, передавшей существующим ветвям признаки кроманьодности ОДНОВРЕМЕННО.

Пример кроманьонца - показатель. Потому что "кроманьодность третьей стороны" - исключена. Её неоткуда было взять, ибо не было во внешней природе - более развитой третьей стороны (если исключить фантастику с инопланетным воздействием).
Строго говоря, кроманьонец - это вообще чудо похлеще хромосомного набора. Ни одна наука по отдельности, ни вся наука в целом - пока не в состоянии внятно объяснить, как такое чудо получилось. Первые сапиенсы сосуществовали с другими видами Homo несколько сотен тысяч лет и не могли их победить, ибо жили малыми группами, как и их соседи неандеры/денисовцы (собственно как и высшие приматы). А кроманьонец оказался способен мигрировать средними группами, и занял планету в "один миг" по историческим меркам. Затем, в эпоху неолитической революции - кроманьонец стал создавать большие группы, и фактически подчинил себе вообще всё живое.

Цитата(В.Юрковец @ 4.10.2012, 23:55) *
Если понгид объединить в одну ветвь (а это так и есть), то и эта проблема исчезает. Человек разошёлся с понгидами 15-20 миллионов лет назад и дальше каждая ветвь пошла своим путём.

Тогда у Вас получится следующая картина: сквозь миллионы лет прошли две ветви, мутировавшие независимо с 48 до 46 хромосом, но приведшие не к двум совершенно разным организмам как этого следовало бы ожидать (см. шимпанзе, горилл, орангутанов - у всех по 48 хромосом, однако ж организмы - совершенно разные), а почему то к одному, причём свободно скрещивающемуся.
Или Вы умеете по внешнему виду отличать A0 от A1 ? wink.gif

Цитата(bugler @ 4.10.2012, 18:09) *
Вот и меня это смущает.

Если по классике - то ничего смутительного нет: сначала внутри нового вида образуются расы/породы, приспосабливаясь к разным средам обитания (скрещивание ещё возможно); затем устаканиваются подвиды (скрещивание ещё возможно); затем происходит обособление в новый вид (скрещивание возможно, но обычно не без проблем). У более простых организмов - возможно даже и межродовое скрещивание.
У более сложных организмов, таких как человек - межродовое скрещивание (с шимпанзе например) не доказано ни разу.

Цитата(Stanislaw @ 22.7.2012, 17:57) *
ISOGG/Krahn подает под BT примерно 115 мутации SNP.
Деля их на 400000 b.p. (WTY у Крагна) я получаю 0.0002875 SNP на 1 b.p.
Деля этот результат через 0,000.000.004 (4х10^-9) SNP в год
я получаю 71,875 лет к коалесценцйи BT.

1. К счастью, наука на наших глазах совершает значительный количественный рывок, выводя данную область знаний - на новый уровень. В рекламной брошюрке про NG Geno 2.0 сказано среди прочего:
"... just 2 years ago, the YCC SNP 2010 tree had a total of just over 800 SNPs that has been discovered. Today it still hasn’t reached 900... Notice that all of the L SNPs were discovered by Thomas Krahn in the Family Tree DNA lab with the assistance of Family Tree DNA’s customers and project administrators. This is truly “crowd-science” in the flash mob sense...
Today, after a concerted effort of discovery involving many people, there are a total of 12,000 Y SNPS and of that, 10,000 of them are unique and new and have never been seen or published before. This means that your haplogroup will automatically be determined to the furthest branch of the tree with no additional SNPs to be tested...
...the haplotree expanded from 862 SNPs to a total of 6153..."

Это значит, что работа Томасом Краном уже проведена, открыты ТЫСЯЧИ новых снипов, на их основе подготовлен коммерческий продукт за 200 долларов, и более точный, чем раньше делали за гораздо более значительные суммы. Для FTDNA, как основного партнёра NG - счёт протестированных пойдёт на миллионы, а это новый уровень и науки и бизнеса.
Забавно, что на дереве FTDNA 2012 пока ещё нет этих "тысяч" снипов и запрет на Perry всё ещё действует, хотя в рекламке - ситуация прояснена донельзя smile.gif

2. Предвидя новый виток игры "откалибруем снипы", хотелось бы упредить и отметить, что SNP всё равно не получится откалибровать для больших сроков в десятки и сотни тысяч лет. Для этого надо знать условно говоря "все снипы во всех ветках" - а их могут быть миллионы.

Автор: Stanislaw 9.10.2012, 20:28

Цитата
Right & Midfield:
Конечно - немножко обидно тем, кто жертвовал финансы на этот проект (например пан Stanislaw) и полгода чего-то ждёт от коммерческой фирмы FTDNA...


По некоторым причинам я решил не писать в этом форуме (даже если кто-то сюда колет меня).
Но время от времени, позвольте мне удовольствие.

1) Признание SNP.
Мы сравнивaем два образца A и B. Например с мутациями M458 и Z280 (но об этом никто не знает).
Одна часть нуклеотидoв повторяется в обоих образцах.
Этo нуклеотиды или SNPs общего предка, Z282, их корень!
Вторая часть нуклеотидoв отличается. Это означает, что произошли мутации в одном или в другом образце.
B котором?
Мы поглядываем на нуклеотыд в маркере ChrY 6289881. Нет там изменения у предка Z282 и у образца B (SNP-). Мы видим, что у образца А.дошло там к изменению C к Т. Это мутация, это SNP, Z280+.
Мы поглядываем теперь на нуклеотыд в маркере ChrY 22775852. Нет там изменения у предка и у образца A (SNP-). Зато в образце B дошло к изменению А-G. Это его SNP М458+ .
Мы так открыли мутации SNP+ и мутации SNP- и и одновременно нуклеотыды предка (корень).

Мы сравниваем SNP трех образцов: A (Z280), B (M458) и C (Z282).
Мы замечаем, что в образце A находятся SNP Z280 i Z282, а в образце B находятся SNP M458 i Z282.
Зато в образце C только SNP Z282.
Этот СНП по-видимому наследован через потомков, итак – он предок, корень для потомков.
Так образовывается иерархия SNPoв, целых к первому предку, то есть Адаму.

2) Давайте переедем теперь вверх деревья.
Cruciani тестировал африканца по племени Bakola. Сравнил его образец с образцами другой, африкан и неафрыканцев.
Большинство из числа 400.000 пар оснований было тождественное.
Были это нуклеотыды предка для А1b и А1а-Т (теперь А0 и А1).
Это были нуклеотыды и (неопознанное) SNPs общего Корня, Adama.

Были тоже y Bakola нуклеотыды отличающееся между этими двумя ветвями, мутированэ, то есть SNPs. Но которой стороне их приписать? Этой стороне, которая имеет нуклеотыд другой чем шимпанзе.

3) Потом было тэстирование Перри.
Тут тоже были многочисленные нуклеотыды тождественное с этими у образцов А1 и они обозначили нуклеотыду или (неопознанныe) SNPs общего корня, Адама.
Корень так не надо искать ни догадываться.
Пользуется известностью он и непосредственно близкий для А0 и А1.
Нет никакого произвола!


В образце Перри нашли тоже много мутаций в отношении к А1, примерно 80.
По сравнению с нуклеотыдами шимпанзе часть по ним была приписана к А0, и часть к А1.
http://www.tropie.tarnow.opoka.org.pl/adam_root2012.pdf

Нет, так и не может быть никакой третьей особой ветви!
Нет потребности искать способа укожененя.
Корень пользуется известностью.
Он запечатленный в образцах А0 и А1.


Если я с чего сбился, уважаемая Люда меня поправит!

Автор: Люда 9.10.2012, 21:08

Right & Midfield, только вечером увидела ваш ответ. На такие пространные ответы у меня возможности нет. Кратко:
1. М91 - ну какая это метка, если маркер скачет. Я не знала (Игорь написал), у кого-то уже найдено 10Т в этом сайте. Cruciani пишет - менее, чем у 1/3 исследованных, и людей и шимпанзе, сохранялись 9Т. Что немудрено для гомополимерного района. У шимпанзе скачет. А вы хотите выстроить Древо так, что 1 ветвь от 8Т-шимпанзе, другая от 9Т-шимпанзе.
2.

Цитата
он всё-таки не стал менять "точку опоры" - отказался от сравнения шимпанзе с людьми - ещё и для доказательства "удобного" варианта. Cruciani пошёл другим путём - предложил свои V-SNP.

Почему вы так решили? Cruciani пишет - Дерево укоренено по 146 снипам - либо по MSY последовательности шимпанзе (131 сайт в Х-degenerated MSY), либо по Х-хромосоме человека (15 сайтов в Х-transposed MSY).
3.
Цитата
мы сильно недоумеваем, когда читаем фразы типа: "Пока снипы Перри не будут опубликованы в полном варианте
В этом я с вами согласна. Тоже думаю, что все снипы уже заявлены. Могут быть только перемещения из группы в группу, но это мы и сами в состоянии сделать. Может быть, что-то есть, что нам пока неизвестно. Так, на 1.09. большая часть снипов Перри стала вроде как общей для А0 (но тоже не до конца понятно-прерываются знаками вопросов).
4.
Цитата
Ведь мы же ещё в феврале говорили про то что Perry=root на деревьях 2012, что у Perry минусы во всех снипах...
Еще раз - как он может быть root?
Цитата
у Perry минусы во всех снипах...
У него минусы в наших снипах, а у нас минусы в его снипах. Параллельная ветвь к А1.
5.
Цитата
провести с V-снипами Perry - аналогичную работу
естественно, все проведено и здесь обсуждалось.
6.
Цитата
Для иллюстрации - выкладываем дерево FTDNA 2012 в нашем представлении
Не все просмотрела. Какой информацией вы пользуетесь? На последнем Древе группа снипов L1086-1163, где она у вас? Может быть, вы владеете какой-то еще информацией? И на вашем Древе А0 и А1Т братья. Адам, не поняла, брат?, наверно все-таки, отец. И у вас ВТ последовательно за А1Т. Что же вы говорили о ВТ-первородстве?
7.
Цитата
Так как Perry=root на деревьях 2012, то не только снипы V-серии у него все по минусу...
Естественно. А как иначе? Те снипы, что выявлены до Перри, выверены по шимпанзе и снипы они потому, что отличаются от последовательности шимпанзе. А когда выявили массу новых снипов у А0 (и выложили их), то это были снипы по отношению к нам. А при проверке предкового значения оказалось, что часть этих снипов не отличает его от шимпанзе. Значит, это мы, этими снипами, отличаемся от шимпанзе. Эта работа и была здесь проведена. Древо от 1.09. (не знаю, чье?) и учло практически все наши замечания. Только где
Цитата
Perry=root на деревьях 2012
?
8. Куда нам нужно успеть, не поняла.

Автор: Люда 9.10.2012, 21:18

Пока писала ответ, уважаемый Станислав подключился.

Цитата
Нет, так и не может быть никакой третьей особой ветви!

На последнем Древе - да, их не 3, всего 2, но они параллельные. Мое мнение с марта месяца не изменилось. Братья-братья, но возраст Отца почтенный.
Цитата
Пользуется известностью он и непосредственно близкий для А0 и А1.

Ой, не близкий. Но это нормально. Определят со временем.

Автор: В.Юрковец 9.10.2012, 21:37

Цитата(Right & Midfield @ 9.10.2012, 21:23) *
...
Цитата(В.Юрковец @ 4.10.2012, 23:55) *
Если понгид объединить в одну ветвь (а это так и есть), то и эта проблема исчезает. Человек разошёлся с понгидами 15-20 миллионов лет назад и дальше каждая ветвь пошла своим путём.

Тогда у Вас получится следующая картина: сквозь миллионы лет прошли две ветви, мутировавшие независимо с 48 до 46 хромосом, но приведшие не к двум совершенно разным организмам как этого следовало бы ожидать (см. шимпанзе, горилл, орангутанов - у всех по 48 хромосом, однако ж организмы - совершенно разные), а почему то к одному, причём свободно скрещивающемуся.
Или Вы умеете по внешнему виду отличать A0 от A1 ? wink.gif ...

Две ветви-то зачем? Одной достаточно. А уж сколько было организмов можно посмотреть вот здесь, например - http://antropogenez.ru/derevo/ .

Автор: Stanislaw 9.10.2012, 21:47

Цитата(Люда @ 9.10.2012, 21:18) *
Пока писала ответ, уважаемый Станислав подключился.
Цитата
Нет, так и не может быть никакой третьей особой ветви!
На последнем Древе - да, их не 3, всего 2, но они параллельные. Мое мнение с марта месяца не изменилось. Братья-братья, но возраст Отца почтенный.
Цитата
Пользуется известностью он и непосредственно близкий для А0 и А1.

Ой, не близкий. Но это нормально. Определят со временем.

Люда, я думаю, чтобы точнее писать: А0 и А1 не паралельнэ, но расходятся как вилка. B ней нуклеотыды общее это корень.
Он разветвляется на SNP А0 и SNP А1.
Линии А0 и А1 выходят (с своими СНП) непосредственно из этого разветвляющегося корня. Они расходятся от корня (Адама) на двe линии SNP: A0 и A1



Автор: Stanislaw 9.10.2012, 21:52

Right & Midfield,
Перри не может быть корнем дерева, потому что тогда весь его SNP были бы вынужденные быть в нас, в А0 и А1 (A к R).
А так не!

Автор: Люда 9.10.2012, 22:26

Stanislaw, мы с Вами уже это обсуждали. Расходятся из одной точки, но очень-очень давно и дальше идут параллельно. Это можно сказать и о неандертальцах, и о других гоминидах. Наверно, конечно, А0 поближе к нам.

Автор: Stanislaw 9.10.2012, 22:39

Цитата(Люда @ 9.10.2012, 23:26) *
Stanislaw, мы с Вами уже это обсуждали. Расходятся из одной точки, но очень-очень давно и дальше идут параллельно. Это можно сказать и о неандертальцах, и о других гоминидах. Наверно, конечно, А0 поближе к нам.

Это мнимая параллельность.
В отцовской линии Y-DNA и матчынэй mtDNA мы с каждую новую мутацией отдаляем себя от себя.
Параллельность мнимая.
Касается это не только А0, но всех групп.
Радует меня то, что у нас общий предок и многочисленное аутосомальнэ соединения.

Автор: Люда 9.10.2012, 22:50

Цитата
Касается это не только А0, но всех групп.
Да нет, все группы выстроились одна за другой, а А0 параллельная.
многочисленное аутосомальнэ соединения об аутосомах А0 я ничего не слышала.

Автор: Stanislaw 10.10.2012, 8:33

Цитата(Люда @ 9.10.2012, 22:50) *
Цитата
Касается это не только А0, но всех групп.
Да нет, все группы выстроились одна за другой, а А0 параллельная.
многочисленное аутосомальнэ соединения об аутосомах А0 я ничего не слышала.

Когда мы возьмем например группы
К -> NO -> N
К -> P -> R
К-M526 - это корень, а остаток - это рога вилки.
Потомки мутации К в хромосоме Y все больше отдаляют себя от себя.
Мы в автосомax непрерывно по-прежнему, потому что мы вступаем в брак и у нас общие ребята.

Относительно А0 такое объединение c A1 и его субклядами в автосомax всегда покрывалось в Африке,
а через колониальный период таже и вне Африки.
Но я сознательный, что это ты знаешь.

Автор: Люда 10.10.2012, 9:21

Stanislaw, а я подумала, что А0 тестировали на Geno2.0 и Вы знаете что-то о его результатах по аутосомам. Думаю, их должны были тестировать.

Автор: Stanislaw 10.10.2012, 11:04

Цитата(Люда @ 10.10.2012, 10:21) *
Stanislaw, а я подумала, что А0 тестировали на Geno2.0 и Вы знаете что-то о его результатах по аутосомам. Думаю, их должны были тестировать.

Люда,
на Geno2.0 нет тэстирования аутосомов.
А что касается А0, это теперь они не живут в таком обособлении, какой может болээдавно.
Живут напр. в нескольких племенах, расходящихся антропологический!
Так наверное был обмен аутосомов.

Автор: Igor1961 10.10.2012, 11:10

Уважаемые пан Станислав и Right & Midfield, вам не кажется, что ваши рассуждения о корнях, Адамах и прочих абстракциях все больше напоминают известный рассказ Д. Хармса, что начинается словами:"Дорогой Никандр Андреевич, получил твое письмо и сразу понял, что оно от тебя. Сначало подумал, что оно вдруг не от тебя, но как только распечатал, сразу понял, что от тебя,а то было подумал, что оно не от тебя."
http://petrenko.ru/lib/story.php?x=3&t=184

Далее персонаж рассказа вязнет в бесконечных повторах и речевых оборотах, пока они не затягивают его с головой. К чести автора, в конце он обрывает этот поток сознания, и заканчивет вполне внятной фразой:"Передай привет твоей новой жене".

Может, поучимся у классиков и станем говорить по существу?

Автор: Люда 10.10.2012, 11:28

Stanislaw, как же нет снипов на аутосомы? Как раз большая часть снипов именно на них. 130000 вроде бы (по памяти).

Автор: В.Юрковец 10.10.2012, 11:31

Было бы неплохо ещё, если бы пан Станислав объяснил, почему они на своём старом форуме гаплогруппу А0 назвали "примитивной". Расизм не приветствуется на нашем форуме.

Автор: Right & Midfield 10.10.2012, 11:54

Цитата(Люда @ 9.10.2012, 23:26) *
1. Расходятся из одной точки, но очень-очень давно
2. и дальше идут параллельно.

1. Текст "очень-очень давно" - имеет количественную оценку. Примерно ~200 тлн. Оценка приходит из как минимум трёх независимых методов:
а) ископаемые останки сапиенса Идалту, "брата" Y-Адама.
б) расчёт возраста митохондриальной Евы по mt-DNA, "жены" Y-Адама.
в) расчёт возраста самого Y-Адама по STR.
2. Если линии расходятся из одной точки (а они расходятся из одной точки), то это значит, что у них есть общий предок, которого обычно называют Y-Адам.
Текст "параллельно", равно как и любой другой текст, например "перпендикулярно", "зигзагами", "волнами", "крестиком" - к филогении никакого отношения не имеет, ну типа как "литературный вымысел в художественной обработке".

Цитата(В.Юрковец @ 9.10.2012, 22:37) *
Две ветви-то зачем? Одной достаточно.

1. Вот текст автора тезиса про две ветви: "Две из них - это (а) потомки общего предка современного человека и современного шимпанзе, и (б) потомки чернокожей линии, получившей сейчас условное название А0".
http://www.rodstvo.ru/forum/index.php?s=&showtopic=3158&view=findpost&p=96077
2. Вот наш контраргумент: "Изменение хромосомного набора на двух параллельных ветвях с 46 до 48 - это из разряда фантастики".
http://www.rodstvo.ru/forum/index.php?s=&showtopic=3158&view=findpost&p=96164
3. Таким образом, мы не знаем "зачем две ветви" - автору тезиса про две ветви. Равно как и не понимаем - почему Вы адресуете вопрос нам, а не автору тезиса?

Цитата(Stanislaw @ 9.10.2012, 21:28) *
Нет потребности искать способа укожененя.

Сорри, но мы категорически не согласны с таким подходом к жизни. У человечества - есть такая потребность. Равно как есть потребность делать первый шаг, второй шаг... и вот так постепенно - добираться до Америки (несколько раз и с разных сторон), до Луны, до Марса, и т.д.
Вот и у нас - есть потребность искать способ укоренения. По состоянию наших знаний на текущий момент - претендентов не так уж много: A1*/A1b, A1a, A2/A3, BT (в нотации ISOGG 2011).

Цитата(Stanislaw @ 9.10.2012, 22:52) *
1. Перри не может быть корнем дерева,
2. потому что тогда весь его SNP были бы вынужденные быть в нас, в А0 и А1 (A к R). А так не!

1. Может. А в гипотезе Кручиани - не только может, но и является. И так как деревья с февраля 2012 года - FTDNA и ISOGG перерисовывали исходя из гипотезы Кручиани - то и на этих деревьях Perry=root.
2. Почему это "а так не"? Это очень даже так, ибо V168- и V166-. Из чего следует, что Perry не является ни A0, ни A1 (в нотации FTDNA 2012), и ему остаётся единственное место на дереве - в корне; что полностью соответствует тому варианту, который выбрала программа Кручиани. И действительно - все снипы, которые были известно до появления Perry - у него идут с минусом, а у субкладов A0 и A1 - с плюсом, что совершенно естественно для гипотезы Кручиани.
3. Таким образом, если Вы считаете, что гипотеза Кручиани - верна, то уж будьте любезны - придерживайтесь её корректно, а не абы как. Не бывает так, чтобы и рыбку съесть и одновременно сковородку не почистить. Не бывает так, чтобы Perry=root, и чтобы ему одновременно нашлось место где-нибудь ниже root.

Цитата(Люда @ 9.10.2012, 22:08) *
М91 - ну какая это метка

Обыкновенная. По которой мы можем отметить. Отметить, что у Y-Адама могло быть 8T или 9T. Индикатор, флажок, маркер, показатель, метка... - назвать можно как угодно, суть не изменится:
с помощью M91 можно сделать вывод о том, что существует как минимум две гипотезы по поводу количества повторов тимина у Y-Адама. И ни одну из гипотез - отбрасывать нельзя, с точки зрения научного подхода.
Мы например не можем ни доказать ни опровергнуть - ни одной из этих гипотез, поэтому продолжаем рассматривать обе. Кручиани тоже не смог ни доказать ни опровергнуть ни одной из этих гипотез, но для того чтобы не продолжать рассматривать обе - одну гипотезу отбросил, по совершенно надуманному поводу. Ибо нестабильность снипа - надуманный повод, ведь снип нестабилен в обеих гипотезах. Что ж он тогда и вторую гипотезу не отбросил?
А ответ простой: одна из гипотез была нужна Кручиани для собственной теории, а другая - мало того что не нужна, так ещё и мешалась - прямо противоречила его теории.

Цитата(Люда @ 9.10.2012, 22:08) *
если маркер скачет

Да и пусть себе дальше скачет. Мы же уже говорили, что конечно же снип M91=9T недостаточен для доказательства "первородства" группы BT, если опираться на него как на единственный аргумент. Но речь то о другом идёт - о том, что с помощью этого снипа - можно предполагать, а не что с помощью этого снипа - можно доказывать. Предполагать можно - как минимум две гипотезы про Y-Адама (8T или 9T), а доказывать - ни одной.

Цитата(Люда @ 9.10.2012, 22:08) *
Почему вы так решили?

Это не мы решили - это Кручиани так решил. Повторимся: он решил не менять "точку опоры", т.е не использовать шимпанзе 8T или шимпанзе 9T - для доказательства своей теории. На наш взгляд, это-то как раз в его работе - вполне корректно. Повторимся: Кручиани стал доказывать свою теорию - другим способом, а именно - предложил использовать свои V-SNP.

Цитата(Люда @ 9.10.2012, 22:08) *
А вы хотите выстроить Древо так, что 1 ветвь от 8Т-шимпанзе, другая от 9Т-шимпанзе.

Не было такого. Мы последовательно отстаиваем позицию, что точка входа - была одна. Возможно, Вы перепутали нас - с нашими оппонентами.

Автор: Right & Midfield 10.10.2012, 12:09

Цитата(Люда @ 9.10.2012, 22:08) *
Так, на 1.09. большая часть снипов Перри стала вроде как общей для А0 (но тоже не до конца понятно-прерываются знаками вопросов)...
У него минусы в наших снипах, а у нас минусы в его снипах. Параллельная ветвь к А1.

Откуда Вы всё это взяли? Покажите пожалуйста источник.

Цитата(Люда @ 9.10.2012, 22:08) *
Не все просмотрела. Какой информацией вы пользуетесь?

???
Мы же написали: FTDNA 2012. Открытые общедоступные данные.

Цитата(Люда @ 9.10.2012, 22:08) *
На последнем Древе группа снипов L1086-1163, где она у вас?

Почему у нас? Этой группы снипов нет на FTDNA 2012 - поэтому и мы их не указали.
Скажите пожалуйста, про чьё "последнее Древо" Вы ведёте речь?

Цитата(Люда @ 9.10.2012, 22:08) *
Может быть, вы владеете какой-то еще информацией?

Мы просто перерисовали FTDNA 2012 - в excel. Для лучшей иллюстрации.

Цитата(Люда @ 9.10.2012, 22:08) *
И на вашем Древе А0 и А1Т братья. Адам, не поняла, брат?, наверно все-таки, отец. ?

Не на нашем, а на FTDNA 2012.
Да, у Кручиани, а значит и у FTDNA - группы A0 и A1-T - это братья. И соответственно: да, Адам=Perry=root - это их отец; у Кручиани, а значит и у FTDNA.

Цитата(Люда @ 9.10.2012, 22:08) *
И у вас ВТ последовательно за А1Т. Что же вы говорили о ВТ-первородстве?

???
Мы же написали: выкладываем дерево FTDNA 2012, а не дерево с нашей гипотезой о BT-первородстве.

Цитата(Люда @ 9.10.2012, 22:08) *
Естественно. А как иначе?

Иначе - бывает. Бывает, когда люди начинают пытаться пристроить Perry - ниже root на деревьях, основанных на гипотезе Кручиани. Но тогда у Perry появляются плюсовые снипы (по крайней мере из известных снипов на момент появления Perry в проекте FTDNA). Поэтому пристроить Perry ниже root - опять не удаётся, и игра начинается сначала. Вместо того, чтобы просто понять - что Perry=root; у Кручиани, а значит и на FTDNA.

Цитата(Люда @ 9.10.2012, 22:08) *
Древо от 1.09. (не знаю, чье?) и учло практически все наши замечания.

Чьё дерево-то? Припомните пожалуйста. Интересно посмотреть на такое дерево, которое учло хотя бы Ваши пожелания.

Цитата(Люда @ 9.10.2012, 22:08) *
Куда нам нужно успеть, не поняла.

Вот же, недавно написано: "Статья по итогам этого исследования сейчас в печати в журнале Advances in Anthropology".
http://www.rodstvo.ru/forum/index.php?s=&showtopic=3158&view=findpost&p=96099

Автор: bugler 10.10.2012, 12:23

Цитата(Right & Midfield @ 9.10.2012, 21:23) *
...
Цитата(bugler @ 4.10.2012, 18:09) *
Вот и меня это смущает.

Если по классике - то ничего смутительного нет: сначала внутри нового вида образуются расы/породы, приспосабливаясь к разным средам обитания (скрещивание ещё возможно); затем устаканиваются подвиды (скрещивание ещё возможно); затем происходит обособление в новый вид (скрещивание возможно, но обычно не без проблем). У более простых организмов - возможно даже и межродовое скрещивание.
У более сложных организмов, таких как человек - межродовое скрещивание (с шимпанзе например) не доказано ни разу.
...


Наконец-то, произнесена почти правильная мысль. "Почти" потому, что межродовое скрещивание действительно осуществлется между видами, но в пределах одного семейства. Учитывая что в семействе Hominidae остался один вид - Homo sapiens sapiens, то скрещивание с шимпанзе это из разряда проблем "зелёных" или прокурора.
Этногенез человека это сетевой процесс и поэтому удивляться каким-то "примесям" от неандертальцев и денисовцев не приходится. Не удивлюсь если найдут и от фозилис. Конечный итог - хомо сапиенс в своём расовом разнообразии. Главный признак, который передаётся по наследству, для ДНК-генеалогии - гаплотип. И если Перри был вынесен в отдельную группу, то так оно и есть. Гаплогруппа это безусловно хорошо, но как средство быстрой сортировки. Поэтому и предлагалось вернуться к фактам:
http://www.rodstvo.ru/forum/index.php?showtopic=3158&view=findpost&p=96192

Автор: Igor1961 10.10.2012, 12:23

Цитата(Right & Midfield @ 10.10.2012, 18:09) *
Бывает, когда люди начинают пытаться пристроить Perry - ниже root на деревьях, основанных на гипотезе Кручиани. Но тогда у Perry появляются плюсовые снипы (по крайней мере из известных снипов на момент появления Perry в проекте FTDNA). Поэтому пристроить Perry ниже root - опять не удаётся, и игра начинается сначала. Вместо того, чтобы просто понять - что Perry=root; у Кручиани, а значит и на FTDNA.

Цитата(Даниил Хармс Письмо)
Я рад, что ты уже давно женился, потому что когда человек женится на том, на ком он хотел жениться, то значит, он добился того, чего хотел. И вот я очень рад, что ты женился, потому что когда человек женится на том, на ком хотел, то значит, он добился того, чего хотел.

blink.gif

Автор: Right & Midfield 10.10.2012, 13:38

Цитата(Люда @ 9.10.2012, 22:08) *
провести с V-снипами Perry - аналогичную работу
естественно, все проведено

Постойте, как это?
1. Вот же, недавно написано:
http://www.rodstvo.ru/forum/index.php?s=&showtopic=3158&view=findpost&p=96099
"Дерево, построенное с учетом снипов, STR и 3-х возможных вариантов размещения корня уже было посчитано. В нем учтены все снипы, доступные с сервера Finch2 для рассматриваемых участников WTY, как "удобные" кому-то, так и "неудобные". Достаточно зайти на эту вот ссылку:"
http://www.rodstvo.ru/forum/index.php?s=&showtopic=2866&view=findpost&p=90775

2. Идём по ссылке - действительно видим дерево с 3-мя возможными вариантами размещения корня. Читаем сопроводительный текст: "Пока снипы Перри не будут опубликованы в полном варианте (с серией V, как минимум), нам остается только гадать, из каких мотивов исходит Томас, присваивая предковые нуклеотиды в том или ином фрагменте...
Без снипов Перри пока нет возможности определить, к какой из 3-х теоретически возможных частей дерева прикрепляется ветвь, соединяющая нас с шимпанзе.
"

3. Мы конечно недоумеваем, ибо ещё в феврале говорили, про то что Perry=root, и про то что у него все минусы...
но,
из желания помочь - пишем пост:
http://www.rodstvo.ru/forum/index.php?s=&showtopic=3158&view=findpost&p=96421
"...если нужны V-SNP Perry, то пожалуйста: читаем работу Cruciani, заходим в приложение Table S2, забираем все предковые аллели у всех V-SNP - это аллели Perry. Ну ничего же сложного!
...Там же - Вы можете забрать и значения потомковых аллелей. То есть: Вы изначально могли, и теперь уж точно можете (если разобрались) - провести с V-снипами Perry - аналогичную работу, такую же, которую Вы уже провели со снипами серии L. Таким образом, Вы можете усовершенствовать свою гипотезу: уточнить "точку входа от шимпанзе" с трёх до одной единственной... Так как Perry=root на деревьях 2012, то не только снипы V-серии у него все по минусу, но и вообще все известные ранее снипы всех серий - тоже по минусу. Если Вам для своей гипотезы - захочется сравнить Perry, шимпанзе и людей - не только по снипам серий L и V, то Вы можете взять вообще любой снип, обнаруженный до появления Perry на проекте FTDNA - у Perry будет предковое значение аллели, а у тех снипов, что уже были ранее "раскиданы" по веткам гаплогрупп - будет потомковое значение аллели... Удачи Вам!"

4. Далее мы даём ссылку на наш файл, который представляет из себя нынешнее дерево FTDNA 2012, но нарисованное в excel чтобы добавить фамилии - для иллюстрации Вам, что Ваше дерево и дерево FTDNA - имеют принципиально одинаковую топологию - Вы что, не видите этого потому что оба дерева повёрнуты на 90 градусов от того способа каким Вы привыкли смотреть?
Просто у Вашего дерева - пока ещё три предполагаемых точки входа:
нижняя, которая ведёт на плечо A1, и которую мы в нашем файле пометили цифрой три;
средняя, которая ведёт на плечо A0, и которую мы в нашем файле пометили цифрой два;
верхняя, которая ведёт к Perry, и которую мы в нашем файле пометили цифрой один.
А у дерева FTDNA - не три предполагаемых точки входа, а изначально одна точка входа Кручиани - верхняя на Вашем дереве, которую мы в нашем файле пометили цифрой один. Это Perry=root.

5. Но теперь Вы отвечаете, что "естественно, всё проведено"...
Как это понимать?
а) Может быть Igor1961 нашёл единственную точку входа в Вашей гипотезе из трёх точек, но закрыл от общественности результаты исследований, одновременно критикуя Томаса Крана за то, что тот... закрыл от общественности результаты исследований Perry?
Мы в это верить не хотим... Для нас - помочь Вам в решении задачи - это гордость за русскоязычный форум, который возможно "прокачал" снипы Y-Адама, и не на основании какой-то там компьютерной программы Кручиани, разместившей корень случайным образом, а на основании Вашей гипотезы...
б) или может Вы заблуждаетесь? Ну то есть - Вы считаете что провели всю работу (дошли до трёх точек входа), а на самом деле - провели не всю работу (не дошли до одной единственной точки входа). Но ведь мы ведём речь не о том, что Вы вообще ничего не делали (это разумеется не так, и мы уважаем чужой труд) - а об усовершенствовании Вашей же гипотезы до логического конца. Поэтому пожалуйста, вернитесь немного назад, на пункт 3 данного поста. Может ещё успеете до выхода журнала - улучшить Вашу гипотезу с трёх точек входа до одной единственной. А то ведь со дня на день - Томас Кран всех опередит, у него в загашнике - несколько тысяч новых снипов, и наверняка есть ответ про корень.

Автор: Stanislaw 10.10.2012, 16:06

Цитата(Люда @ 10.10.2012, 11:28) *
Stanislaw, как же нет снипов на аутосомы? Как раз большая часть снипов именно на них. 130000 вроде бы (по памяти).

Я писал: "Люда, на Geno2.0 нет тэстирования аутосомов."
Люда, я писал об этой программе Гэно2.0, которая теперь пущена.
Интересуют её только все генеалогическое древо SNP Y-DNA и mtDNA человека, а не близкие генеалогия к 5-6 поколениям, открыванное через аутосомальнэ SNP.

Цитата
Stanislaw, а я подумала, что А0 тестировали на Geno2.0 и Вы знаете что-то о его результатах по аутосомам. Думаю, их должны были тестировать.

Это секрет Крагна и Хаммера.

Цитата(Right)
Цитата
Цитата(Stanislaw @ 9.10.2012, 21:28)
Нет потребности искать способа укожененя.

Сорри, но мы категорически не согласны с таким подходом к жизни. У человечества - есть такая потребность. ........
По состоянию наших знаний на текущий момент - претендентов не так уж много: A1*/A1b, A1a, A2/A3, BT (в нотации ISOGG 2011).
Я соглашаюсь. Я смыслю в потребности узнания корня дерева Y-DNA.
Но уже нет потребности его искать, потому что его место пользуется известностью.
Корень на месте, где сбредаются линии А0 и А1 как их МRCA.
Я/мы знаем уже два его мутации SNPs, переданные обудву ветвям (нет их у женщин и шимпанзе).
Это L74 и М91=8Т.
Я/мы знаем тоже его нуклеотыды (по крайней мере их часть).
Одни из их уже мутировали у людей, другое еще нет...

Автор: Люда 10.10.2012, 17:49

Stanislaw

Цитата
программе Гэно2.0, которая теперь пущена.
Интересуют её только все генеалогическое древо SNP Y-DNA и mtDNA человека, а не близкие генеалогия к 5-6 поколениям, открыванное через аутосомальнэ SNP.

Думаю, что это не так, но сейчас не об этом. Я хотела спросить - чьи это Деревья (наверно, Вы их выкладываете здесь). 1ое было Bonnie Schrack от 07.12. А от 01.09. чье, той же группы? Оно отличается от FT.
Right & Midfield, вы видете, что снипы на Древе постоянно тасуются. Сравните вариант FT и тот, что на стр.1 данной темы. Последний вообще прерывается знаками вопросов, которые могут означать все, что угодно.

Автор: Right & Midfield 11.10.2012, 5:31

Цитата(Люда @ 10.10.2012, 18:49) *
Я хотела спросить - чьи это Деревья (наверно, Вы их выкладываете здесь).
1ое было Bonnie Schrack от 07.12.

Так мы и думали...
У неё - работа такая - завлекать народ;
это же ведь главная "заигрывающая", ну или "разыгрывающая" - уж как угодно smile.gif
Вот что она стала писать в феврале:
"Perry's results apparently will establish a third branch of A0, which branches off earlier than the current A0a and A0b. Thus the great interest".

На что мы тогда откомментировали:
"Это уже анекдот получается smile.gif
Сначала мистер Кручиани исследовал все ключевые группы, но не исследовал A1*;
потом его компьютерная программа поместила туда Root (а куда же ещё может поместить Root программа, которой не дали данных по одной из ключевых групп - конечно же на свободное место);
естественно - все дружно потеряли A1*, а когда обнаружился Perry, то все дружно начали искать ему место;
great interest... earlier than the current... sensation... third branch...
Как дети: один спрятал - другие ищут, находят, радуются...
"

Цитата(Люда @ 10.10.2012, 18:49) *
Right & Midfield, вы видете, что снипы на Древе постоянно тасуются.

Мы собственно тогда же, в феврале, и предвидели все эти игры. Несложно было предположить, что раз нашёлся Perry, то будут находиться и другие новые редкие гаплотипы, которые станут сбивать народ с толку.
Поэтому мы предпочли самостоятельно, не доверяя компьютеру, вручную покрутить комбинаторику сочетаний снипов у ключевых гаплогрупп, попереукоренять деревья от разных точек...
Что и помогло нам тогда - выдвинуть гипотезу, что Perry=root.
Да и сейчас пригодилось - когда мы перерисовали в excel нынешнее дерево FTDNA 2012, то нам несложно было разглядеть принципиально одинаковую топологию с Вашим деревом, которое с тремя точками входа от шимпанзе.

Цитата(Люда @ 10.10.2012, 18:49) *
Сравните вариант FT и тот, что на стр.1 данной темы. Последний вообще прерывается знаками вопросов, которые могут означать все, что угодно.

Это не повод опускать руки!
Правильная Ваша гипотеза или нет - время покажет, но её из принципа хотелось бы довести до логического конца. Ну по крайней мере нам - хотелось бы smile.gif

1. Вот смотрите, что получается, если соединить Вашу гипотезу про шимпанзе, с нашей про Perry=root.
Задачка-то Ваша - немного упрощается, если принять, что Perry=root. Тогда не нужно анализировать все SNP у всех групп - нужно ведь выяснить взаимоотношения шимпанзе - только с тремя группами: Perry, A0, A1. Это значит, что и снипы нам нужны только те, которые у Кручиани отходят от нынешнего root - к группе A0:
V148 V149 V154 V157 V165 V166 V167 V172 V173 V176 V177 V190 V196 V223 V225 V229 V233 V239
и к группе A1:
V161.2 V168 V171 V174 V238 V241 V250

2. Данные по шимпанзе - мы взяли из работы Вашей группы в ветке "Out of Africa or out of Eurasia". С сожалением отметив, что Вы могли сформулировать гипотезу полностью - ещё в конце марта...
Данные есть не по всем нужным снипам, но всё-таки в достаточном количестве. Рекомендации по отбрасыванию некоторых снипов - мы вроде бы выполнили.
Данные по Perry - мы, как и советовали Вам - взяли с минусом по всем снипам. Т.е. использовали предковые аллели из Table S2 у Кручиани.
Данные по группам A0 и A1 - общедоступны.

3. Итак, первая колонка - номер V-SNP Кручиани; вторая колонка - Ваш Chimp; третья колонка - наш Perry=root; четвёртая колонка - группа A0; пятая колонка - группа A1.

Сначала смотрим "налево" от корня:
V148 - G G A G
V149 - T T G T
V154 - A A G A
V196 - G G T G
V223 - A A G A
V225 - C C T C
V229 - G G A G
V233 - C C T C
V239 - G G A G
Картинка очевидная: Chimp=Perry=root, а в четвёртой колонке - все мутации у группы A0 (как и должно быть у группы A0).

Затем смотрим "направо" от корня:
V168 - G G G A
V174 - A A A G
V238 - G G G T
V241 - C C C T
Картинка снова очевидная: Chimp=Perry=root, а в пятой колонке - все мутации у группы A1 (как и должно быть у группы A1).

4. Таким образом, Ваша гипотеза улучшается с трёх точек входа от шимпанзе - до одной. На Вашем дереве - это верхняя точка, которую в нашем файле FTDNA 2012 - мы пометили цифрой один. Найденная конечная точка Вашей гипотезы про шимпанзе - совпадает с гипотезой Кручиани. Что наводит на мысль, что он всё-таки как минимум сверялся тоже по шимпанзе... Ну и наш традиционный уже рефрен: Perry=root smile.gif

5. Это ещё не конец. Томас Кран - тоже не дурак.
а) Конечно же - огромная вероятность, что он считает root точно также, и вскоре - подтвердит вышеозвученные гипотезы, ведь дерево он переукоренил давно, и принципиальных изменений - не вносил (за исключением мелочей).
б) но с другой стороны - исследования по Perry до сих пор закрыты; слова про "дюжины ошибок" - сказаны; V-SNP Кручиани у групп BT, B, CT - пока убраны с дерева FTDNA 2012; Бонни Шрэк - жжёт и завлекает...
Т.е. ещё существует небольшая вероятность, что Томас Кран обнаружил что-то принципиально новое, или показал неприменимость использования ДНК современных шимпанзе - для анализа SNP Y-Адама.

В любом случае - ждать развязки осталось совсем недолго.
На подходе - тысячи новых снипов, значительно уточняющих филогению.
Любители STR - расчехляют компьютеры для перерасчёта всего на свете.

Автор: Люда 11.10.2012, 6:59

Right & Midfield, хоть убей, не понимаю, почему по-вашему Перри=root? Ведь тогда мы его потомки, а в нас нет его снипов. Наша ветвь развивалась параллельно его. У него одни L-V, у нас другие. Рассчет времени отделения от общего корня надо вести по сумме снипов в каждой ветви, а она-то (сумма) неизвестна до конца. Как вести по одним V? Буква не имеет никакого значения, нужно суммировать все снипы.
Томас Кран, уверена, считает тоже по шимпанзе. Иначе как бы они перенесли все снипы (почти), на которые мы здесь указывали. Сравните Деревья от 07.03.12 и 01.09.12. Не знаю, правда, висит ли 1ое еще здесь в какой-то теме? Станислав почему-то убирает одно, на его месте появляется следующее (как в этой теме). А ошибок было не меньше 2х дюжин (это если считать грубые - вместо А0 - А1). А внутри А0 до сих пор по схеме 1.09 непонятно местоположение снипов.

Автор: Stanislaw 11.10.2012, 9:29

Цитата(Люда @ 11.10.2012, 6:59) *
Станислав почему-то убирает одно, на его месте появляется следующее (как в этой теме). А ошибок было не меньше 2х дюжин (это если считать грубые - вместо А0 - А1). А внутри А0 до сих пор по схеме 1.09 непонятно местоположение снипов.

Люда,
у меня нет информации прямо от Krahna насчет всех мутации Перри.
Он не опубликовал, которое из новыx (примерно 80) мутации Перри плюс, а которое минус. Не опубликовал, которые из известныx раньше мутаций А0 (V и L) повторились у Перри (неправда, что все на минус, как здесь кто-то пишет).
Я обязал себя не вырывать у них секретов. Пусть работают и пишут покойно.

Я пользуюсь зато четырьмя общественными источниками. Но они не всегда соответствуют со себя. Некоторое подают неактуальное состояние изучение.
Поэтому и у меня изменения и колебания...
Мое дерево служит тому, чтобы видеть общую конструкцию дерева, и особенно место общей гаплёгрупы БТ на дереве человечества; вышла она из-под А1 и А1b и братская для всех африканских линий.
Это дерево уже теперь позволяет тоже подсчитывание времени к Адаму на стороне А1 (который должен быть такой же как в А0).
http://www.tropie.tarnow.opoka.org.pl/adam_root2012.pdf

Люда,
когда мы спорим о мутациях в А0, мы вынужденные знать, как они выявляют себя.
Выявляют себя они по сравнию надежного сегмента Y-DNA A0 и A1(примерно 400.000 пар оснований). Теоретически это весь SNPs, какое возникли между общим прэдком а сегодняшним человеком из A0(=напр. Perry) и A1(=напр. R1a).
Место встречи этих двух линий это уже Root=Adam.

Автор: Люда 11.10.2012, 10:15

Взглянула на новое Дерево, теперь уже от 23.09.(по ссылке Станислава). Все снипы уже не хочется даже сличать. Вот пресловутый Р305. 21.09.12 на стр.№4 данной темы я написала - почему Р305 опять вернули к А0? (Летом его все-таки перебрасывали в А1 от А0.) А в схеме от 23.09 он уже в А1. Быстро реагируют? Кто? Станислав? Кто автор этого Древа от 23.09.? подписи нет.

Автор: Люда 11.10.2012, 10:43

21/09/

Цитата
L1144 в А1 - наверно опечатка, следует читать L1142.

Сейчас исправлена даже опечатка. Станислав, вообще-то так не делается.

Автор: aklyosov 11.10.2012, 13:14

Уважаемая Людмила,

А зачем Вы вообще обращаете внимание на какие-то самодельные "деревья", которые мастерит либо Станислав, либо Шрак, либо кто другой? Уже тот факт, что они постоянно переделываются, говорит о том, что эти люди не владеют информацией, либо интерпретируют как хотят. Никакой ценности эти "деревья" не имеют. Все эти заклинания, типа "root=Adam" тоже не имеют никакого смысла, особенно когда идет постоянная подгонка под это ущербное понятие, и что якобы это непременно в Африке. Более того, идет игра в какие-то секреты, что-то от кого-то "прячут", а толпа прыгает и ждет этих "секретных данных", как будто это кому действительно нужно. Это какой-то массовый психоз, накачиваемый с коммерческими целями, и принимать в этом участие - увольте. Есть необходимый набор основных данных, есть гаплотипы, всё более и более протяженные, и этого достаточно для основных выводов. Статья наша, кстати, окончательно принята, о чем мне сегодня сообщили. Вот от нее и стоит отталкиваться, работая над принципиальными выводами. А там снип номер тысячу-какой-то, к тому же возможно приватный, никакой роли не играет. Опять же, не играет роли никакой Крусиани, и эта игра в "Крусиани прав" - "Крусиани неправ" тоже никакого смысла не имеет. Это все гарнир, не имеющий особенного значения. Тем более что педалируют это люди, сами ничего не делающие, и ничего сами не публикующие. Зачем их вообще слушать?

Автор: Stanislaw 12.10.2012, 11:36

Цитата(Люда @ 11.10.2012, 11:43) *
21/09/
Цитата
L1144 в А1 - наверно опечатка, следует читать L1142.

Сейчас исправлена даже опечатка. Станислав, вообще-то так не делается.

Люда,
нельзя от меня требовать более чем от Крагна и официального учреждения ИСОГГ
Мое дерево не официальное, основанное на тот и других данных.
На нём звание "тэмпорары" и многократно будет модифицироваться вместе приливом новых информаций.

1) что касатся P305.
Кrahn только с конца июня тестирует его под А1 как P305+.
Зато ISOGG до сегодняшнего дня помещает P305 под А0 !!!
Отсюда походит мое колебание. Но я уже знаю - проверил весь WTY от июля к сентябрю.
Выявление второй линии человечеству (А0, Cruciani) открыло новые методы снипования, но к слову стало причиной потребности серии поправок на разных порталах, отсюда этот период замешательства.

2) что касается L1144 / L1142
За переносом некоторыx SNPs с правой слева и наоборот повторился два раза L1144, а выпал L1142. Ошибка починена.
Такие ошибки случаются и в ISOGG, хотя об нём заботится коллектив.
Я сам уже четырежды предложил им поправки, которые были выполнены.
У меня тоже наверное будут - по очередной проверке SNPs, которые поддались или претерпят изменение. На Geno 2.0 проводится очередной контроль SNPs, раскрытыx когда-то разными фирмами в первоначальной примитивной тэхонолёгии, дублированныx (под другими названиями) или перенесенныx из одной стороны на вторую.

Автор: Люда 12.10.2012, 13:00

Cтанислав, поняла - это Древо "Ваше" и Вы берете отовсюду, кто-что скажет. Вы бы тогда сказали - спасибо, опечатку исправил, Р305 и еще дюжину снипов перенес из группы в группу.

Цитата
Ошибка починена.

А я что, корректор?

Автор: Stanislaw 12.10.2012, 13:28

Цитата(Люда @ 12.10.2012, 14:00) *
А я что, корректор?

C большим удовольствием
на моей стороне

Автор: aklyosov 12.10.2012, 13:50

Cтроить свое дерево гаплогрупп и субкладов (пусть на основании чужих данных) - дело похвальное. Только надо честно указывать, кто автор дерева, давать ссылки, и понимать, зачем это дерево нужно. Я бы советовал у этого дерева пояснить, чем оно отличается от текущих деревьев Крана и ISOGG, на каком основании внесены изменения, и что они дают в понимании динамики происхождения человечества (мужской его половины). Тогда каждое изменение на дереве будет поясняться, и это самое полезное.

А просто так втихую строить, не подписываясь, и якобы выдавать за современное дерево, без пояснений, это вызывает заслуженное недоверие, и вообще отталкивание.

Автор: Right & Midfield 13.10.2012, 21:31

Цитата(Stanislaw @ 11.10.2012, 10:29) *
у меня нет информации прямо от Krahna насчет всех мутации Перри. Он не опубликовал, которое из новыx (примерно 80) мутации Перри плюс, а которое минус. Не опубликовал, которые из известныx раньше мутаций А0 (V и L) повторились у Перри (неправда, что все на минус, как здесь кто-то пишет).

1. По поводу снипов серии V.
У группы Perry - все минусы.
2. По поводу снипов серии L.
Среди этих снипов - очень много НОВЫХ, которые исследованы ПОСЛЕ того, как на проекте FTDNA появился Perry и другие гаплотипы из группы Perry. Конечно же, какие-то из них - могут быть с минусом, а какие-то - с плюсом. Но какие именно - мы пока не знаем точно. Их то покажут в списке снипов "до выяснения" (но не на дереве), то оставят на дереве в группе A0, то переместят в группу A1, то вовсе уберут с дерева... Короче говоря - работают, исследуют, формируют новую модель из 12000 снипов. Скоро опубликуют - всё прояснится.

Цитата(Stanislaw @ 12.10.2012, 12:36) *
Кrahn только с конца июня тестирует его под А1 как P305+.
Зато ISOGG до сегодняшнего дня помещает P305 под А0 !

Ну вот, характерный пример. Сначала и FTDNA и ISOGG помещали P305 под A0.
Но ISOGG - не может самостоятельно доисследовать Perry, поэтому до сих пор так и помещает P305 под A0.
А в FTDNA доисследовали Perry, и поняли, что P305 надо переместить под A1.
То есть - аллели не поменялись конечно же, но поменялись знаки.
У группы Perry P305- ; у группы A0 P305- ; у группы A1 P305+.

Цитата(Люда @ 11.10.2012, 7:59) *
хоть убей, не понимаю, почему по-вашему Перри=root?

1. После того как Ваша гипотеза в конце концов привела к этому же результату - Вы говорите, что не понимаете результат...
Что ж, для такой новой области знаний, как ДНК-генеалогия - это нормально. Нет пока такой книжки "Genetic genealogy. Учебник для ВУЗов". Ни у кого из нас - нет и диплома по специальности "Генетическая Генеалогия". Фактически - в новую науку идут люди из самых разных областей знаний, и с самым разным уровнем знаний. Неудивительно, что наши знания - местами фрагментарны. Причём разными "местами" - одни в одном разбираются, другие - в другом; единой теоретической подготовки - объективно не хватает всем. Неудивительно, что мы разговариваем нередко на разных "языках", не всегда понимая друг друга.

2. Может быть Вы не помните, но исследования по Perry закрыли не сразу, а после того как в FTDNA обнаружили, что у Perry V166- и V168-. Это открытые публичные данные. Для модели Кручиани (на основе которой и переукоренили современные деревья в FTDNA и ISOGG) - этот факт означает, что группа Perry - не принадлежит ни группе A0, ни группе A1. Т.е. у группы Perry - нет и не может быть с плюсом - никаких других снипов серии V. Все с минусом; все 146 штук, указанных в Table S2 работы Кручиани.
Мало того - оказалось, что все снипы всех других серий, известные на момент появления гаплотипа Perry в проекте FTDNA - у него тоже тоже с минусом. Как такое может быть? Да очень просто: та модель, которая существовала раньше - прекрасно позволяла определять гаплогруппы у 99,999% протестированных. Несмотря на то, что снипов было мало. Да-да, "первая тысяча снипов", вроде бы прекрасно описывающая все гаплогруппы кроме Perry - это бесконечно мало, капля в море. Потому что снипов - миллионы.
Но вот нашёлся Perry, а затем и ему подобные, и выяснилось, что старая модель - не работает для этих 0,001% протестированных. Если бы Perry был один, то в модели Кручиани ему можно найти только одно место - в корне, коль уж он не принадлежит субкладам корня (не принадлежит ни A0 ни A1). Однако было легко прогнозировать, что найдутся и другие редкие гаплотипы, похожие на Perry, и не похожие на всех остальных людей, т.е. ни на группу A0 ни на группу A1. Но это - уже отдельная гаплогруппа, у которой очевидно появится и субкладистика. И если одного Perry ещё как-то можно было втиснуть в старую модель (в корень), то целую гаплогруппу - уже нельзя, ибо тогда получается, что корень - растёт ещё и вверх, а не только вниз, к группам A0 и A1.
Цитата(Люда @ 11.10.2012, 7:59) *
Ведь тогда мы его потомки, а в нас нет его снипов.

3. Вот потому что Вы пока остаётесь в рамках старой модели - Вы так и говорите. А на самом деле: у нас с группой Perry - миллионы лет единой эволюции, миллионы общих снипов. Расхождение началось всего лишь 200 тлн. Если права Ваша гипотеза про шимпанзе, то расхождение например с группой BT происходило по следующей схеме отношений "предок-потомок": Ваш Chimp - группа Perry - группа A1 - группа BT. На снипах V168, V174, V238, V241 в Вашей гипотезе с нашей "докруткой" - это выглядит так:
Ваш Chimp минус ; группа Perry минус ; группа A1 мутация в плюс ; группа BT сохраняет плюсовую мутацию.
Снипов Perry из старой модели "первой тысячи снипов" - в нас действительно нет. Но снипов - миллионы. И так как согласно гипотезе Кручиани (а теперь и Вашей) группа BT - это потомки Perry, то в группе BT - миллионы снипов Perry.
Их нет на дереве ISOGG 2011? Ну и что. Для задач филогении гаплогрупп - было достаточно относительно небольшого числа снипов, которые у ныне живущих людей - РАЗЛИЧАЮТСЯ. Зачем было искать миллионы снипов, которые у всех людей - ОДИНАКОВЫЕ?

4. Нас поначалу тоже очень смутило, что у корня, который определила программа Кручиани - нет V-SNP снипов, вплоть до того, что мы утверждали - такие снипы нельзя использовать для филогении. Ибо получится, что у Perry не было никаких мутаций со времён Y-Адама, что противоречить самой сути изменчивости... Парадокс в том, что если оставаться в рамках старой модели, то действительно нельзя. С помощью V-SNP, да и вообще всех старых SNP - никак нельзя описать субкладистику группы Perry. А она там прогнозируемо вырисовывается - смотрите на дерево, которое получается после анализа STR: снипов ещё нет, но уже можно предсказывать субклады. Что толку, если мы останемся в рамках старой модели "первой тысячи SNP", и продолжим твердить, что нельзя использовать V-SNP для субкладистики группы Perry? Это всё равно что твердить, будто Земля плоская. Рассылка китов NG Geno 2.0 уже началась, здравствуй "дивный новый мир" 12 000 SNP. Скоро Томас Кран покажет НОВЫЕ снипы, которые и опишут то, что не умещалось в старую модель.
А ведь можно было застолбить целую научную школу, набрать аспирантов, участвовать в сипозиумах, печаться в журналах, "осваивать" гранты... ну и как закономерный итог - дача в Переделкино smile.gif
Только вот все эти "публикации" про то что Земля плоская - выглядят как тщеславный страх потерять былой авторитет, ибо никому не нужны старые знания, когда люди вдруг понимают, что Земля - круглая. В ДНК-генеалогии такое бывает - вспомните хотя бы пресловутые "скорости Животовского".

Цитата(Люда @ 11.10.2012, 7:59) *
Наша ветвь развивалась параллельно его. У него одни L-V, у нас другие.

5. Разумеется, ветвь Perry развивалась отдельно. Но в рамках старой модели - ей нет места, это "ложный брат" для групп A0 и A1. Нужна новая модель, которую сейчас и "устаканивает" Томас Кран. Как он решит противоречие?
Чтобы ответить на этот вопрос - посмотрим на аналогичную историю. В работе Кручиани не хватило V-SNP для чёткого разделения групп A2, A3, BT. Все они были "детьми" снипа V221. Впоследствии обнаружился новый снип L419, который отделил группу BT от групп A2 и A3. Снип V221 перестал быть "отцом" для групп A2 и A3, он стал им "дедушкой", а группа BT - перестала быть "ложным братом" для групп A2 и A3, она стала им "дядей".
V221 (корень)
... L419- (группа BT)
... группа L419+ (A2/A3)
... ... группа A2, L419+, M276+, M32-
... ... группа A3, L419+, M276-, M32+

6. Вот так, или примерно так - и будет выглядеть решение для группы Perry. Найдётся новый промежуточный снип, с условным названием "L9999". Нынешний корень - перестанет быть "отцом" для групп A0 и A1, он станет им "дедушкой", а группа Perry - перестанет быть "ложным братом" для групп A0 и A1, она станет им "дядей".
V166- V168- (корень)
... L9999- (группа Perry)
... группа L9999+ (A0/A1)
... ... группа A0, L9999+, V166+, V168-
... ... группа A1, L9999+, V166-, V168+

Разумеется, у Томаса Крана - тысячи новых снипов в закромах, и решение может быть ещё более сложным, но важно понимать - решение всё равно будет найдено методом НАДСТРОЙКИ над нынешнем корнем, а не попыткой втиснуть группу Perry - ПОД нынешний корень.

Цитата(Люда @ 11.10.2012, 7:59) *
Томас Кран, уверена, считает тоже по шимпанзе. Иначе как бы они перенесли все снипы (почти), на которые мы здесь указывали.

7. Может и по шимпанзе, это вполне вероятно, а может и/или по своему - у него много новой информации, которую он пока не открывает. Они переносят или вообще убирают НОВЫЕ снипы, потому что тоже сначала пытались втиснуть их в СТАРУЮ модель. То есть идёт процесс отладки новой модели, и пока нет цельной картины - какой смысл гадать на кофейной гуще? Какой смысл следовать Бонни или Станиславу или ещё кому - в бессмысленной игре под названием "где Perry"? Только путаница из-за этого...
И резюмируя: у Вас получилось. Ну то есть, мы полагали, что Вы сами "докрутите" свою гипотезу, но потом нам пришлось подключиться, "взять и сделать", раз уж Вы "не верите", что Perry=root. Тем не менее - у Вас получилось независимо от Кручиани построенное дерево, хоть и совпавшее с Кручиани, а значит с нынешней версией FTDNA 2012. Зачем Вам "самодельные" деревья Станислава - теперь?
Цитата(Люда @ 11.10.2012, 7:59) *
Сравните Деревья от 07.03.12 и 01.09.12. Не знаю, правда, висит ли 1ое еще здесь в какой-то теме?

Мы не знаем, где висит первое; а где второе - Вы нам тоже не показали. Как мы их сравним, если не видели ни того, ни другого? Покажите - нам конечно интересно увидеть тот вариант, который Вас устраивал.

Автор: Stanislaw 14.10.2012, 14:18

Уважаемый Right,
1) Oчень я вас прошу, покажите, кто установил и где это написано, что у Перри нет SNPs из V группы и что все у него минус???
Прежде чем мы заплатили тестирование WTY Перри, были тестированы только четыре SNPs, два из группы А0 и два из группы А1 – negative (минус)
Не обозначило это совсем, что другие SNPs из группы А0 * (xA01) не могут быть у Перри плюс !!!

2) Bозможно что весь SNPs по А0 были у Перри минус.
Когда? Когда гриппa SNPs А0 может быть сынами для SNPs Перри. Тогда значительная часть этиx SNP наследована через А0 (у одного Перри может быть только несколько SNPs собственныx).
Так временно написали на дереве от StP.

3) Вы должны всегда помнить, что SNPs обнаружили y Перри (около 80) не являются мифическими, но вытекают из сопоставления Y-ДНК сегментов Perryи групп A1.
Таким образом, SNPs Perry подходят в группу A0, увеличивая его верхнюю часть, потому что они унаследованныe подгруппaми из A0.

4) Если вы абсолютно хотите чтобы Перри был корень дляA0 и A1, а затем покажите мне SNPs наследованное через эти двe группы. В частности, без воображения.

Цитата
6. Вот так, или примерно так - и будет выглядеть решение для группы Perry. Найдётся новый промежуточный снип, с условным названием "L9999". Нынешний корень - перестанет быть "отцом" для групп A0 и A1, он станет им "дедушкой", а группа Perry - перестанет быть "ложным братом" для групп A0 и A1, она станет им "дядей".
V166- V168- (корень)
... L9999- (группа Perry)
... группа L9999+ (A0/A1)
... ... группа A0, L9999+, V166+, V168-
... ... группа A1, L9999+, V166-, V168+

? ? ?
...................................ADAM...................................
...................................ADAM...................................
...................................ADAM...................................
...................................ADAM...................................
...................................ADAM...................................
...................................ADAM...................................
....................................A*.A....................................
...................................A*...A...................................
..................................A*.....A..................................
.................................A*....A0.A1..............................
................................A*.....A0...A1............................
...............................A*......A0.....A1..........................
.............................A*........A0.......A1........................
............................A*.........A0.........A1......................
...........................P............A0.........A1.BT.................
..........................E.............A0..........A1....BT.............
.........................R..............A0...........A1......BT..........
..... .................R................A0............A1.........BT......
......................Y.................A0.............A1...........BT...

Автор: Stanislaw 15.10.2012, 15:41

Цитата(Stanislaw @ 14.10.2012, 15:18) *
.........................ADAM...................................
..........................A*.A....................................
.........................A*...A...................................
........................A*.....A..................................
.......................A*....A0.A1..............................
......................A*.....A0...A1............................
.....................A*......A0.....A1..........................
...................A*........A0.......A1........................
..................A*.........A0.........A1......................
.................P............A0.........A1.BT.................
................E.............A0..........A1....BT.............
...............R..............A0...........A1......BT..........
.............R................A0............A1.........BT......
............Y.................A0.............A1...........BT...

Ли на основании известныx SNPs такое строительство дерева возможнoe?
Так вот сравнивая образец Перри и образцы А-R открыли SNPs:
L1089,1090,1093,1098,1099,1101,1105,1112,1116,1118,1123,1124,1125,
1127,1128,1130, 1132,1135,1136,1137,1142,1143,1145,1150,1153,1155.

Теперь они обнаруживaнныe в WTY A1-R
Полностью возможно, что эти SNPs присутствующиe также в А0.
Поэтому отцовские для A0 и для A1-R.
Связывают оба группы под одним отцом, обозначенным как A.
Такое дерево кажется мне вероятное. Давайте ждем.


Автор: aklyosov 15.10.2012, 20:54

Цитата(Stanislaw @ 15.10.2012, 7:41) *
Теперь они обнаруживaнныe в WTY A1-R
Полностью возможно, что эти SNPs присутствующиe также в А0.
Поэтому отцовские для A0 и для A1-R.
Связывают оба группы под одним отцом, обозначенным как A.
Такое дерево кажется мне вероятное. Давайте ждем.


По-русски это называется "поток сознания". На самом деле это скорее "поток бессознания". Все эти "полностью возможно", совершенно ни к месту. "Отцовские для А0 и для А1-R" - это на самом деле древний общий предок шимпанзе и человека. Что вам "кажется вероятным" - это ваше личное дело, к науке отношения не имеющим.

Поэтому "давайте ждем" тоже не несет никакой смысловой нагрузки. Вы все равно захотите увидеть "Адама", и увидите его в чем угодно, и никакие данные вам не помешают и не просветят. Вы уже "задоктринированы". Чего ждать-то вы собираетесь? Любое отклонение от вашего "Адама" - для вас "расизм". Вы себя за рамки науки давно вывели.

Автор: Stanislaw 16.10.2012, 10:26

Цитата
Вы все равно захотите увидеть "Адама"...Вы себя за рамки науки давно вывели

Определение ”Адам” ”хромосомный Адам” в науке и университетских учебниках генетики всем известнo. Извeстный в мире науки учебник генетики ”Genomes” (T.A. Brown, Manchester) определяет:
"Открытие ‘митохондриальной Евы’, в результате новая модель происхождения современного человека [...] ‘Адам хромосомы Y’, жил тоже примерно 200.000 лет назад в Африке. Конечно не имели они ничего общего с библейскими лицами носящими эти имена [...]. Просто это у них были первоначальные последовательности DNA митохондряльнэ и хромосомы Y, от которыx происходят все последовательности у живущих теперь людей ".
Я здесь сложу, что библейское слово (имя?) Адам метит просто ‘человек’ .
(гэбр. adamah ‘человек из земли’).
Откуда так эта аллергия на слово Адам? smile.gif

Цитата
Вы..., вы..., вы..., вам..., вашего...
„Вы” - Что это такое? Я в международном словаре науки не нахожу
дефиниции этого определения! wink.gif

Автор: Stanislaw 16.10.2012, 11:06

Цитата(Люда @ 10.10.2012, 17:49) *
Stanislaw
Цитата
программе Гэно2.0, которая теперь пущена.
Интересуют её только все генеалогическое древо SNP Y-DNA и mtDNA человека, а не близкие генеалогия к 5-6 поколениям, открыванное через аутосомальнэ SNP.

Думаю, что это не так, но сейчас не об этом. Я хотела спросить - чьи это Деревья (наверно, Вы их выкладываете здесь). 1ое было Bonnie Schrack от 07.12. А от 01.09. чье, той же группы? Оно отличается от FT.
Извините. Моя ошибка. Это то, что было написано о STR, я добрался до аутосом.


Автор: aklyosov 16.10.2012, 17:45

Цитата(Stanislaw @ 16.10.2012, 2:26) *
Цитата
Вы все равно захотите увидеть "Адама"...Вы себя за рамки науки давно вывели

Определение ”Адам” ”хромосомный Адам” в науке и университетских учебниках генетики всем известнo. Извeстный в мире науки учебник генетики ”Genomes” (T.A. Brown, Manchester) определяет:
"Открытие ‘митохондриальной Евы’, в результате новая модель происхождения современного человека [...] ‘Адам хромосомы Y’, жил тоже примерно 200.000 лет назад в Африке. Конечно не имели они ничего общего с библейскими лицами носящими эти имена [...]. Просто это у них были первоначальные последовательности DNA митохондряльнэ и хромосомы Y, от которыx происходят все последовательности у живущих теперь людей ".

Откуда так эта аллергия на слово Адам?


Меня не интересуют неправильные или двусмысленные определения в учебниках. Те, кто по ним учатся, или выучатся и поймут, что это было неправильно, или не поймут никогда. Имеется масса примеров тех и других. Поэтому кивать на учебник как на истину в высшей инстанции, тем более в тех случаях, когда понятия и определения еще не устоялись, может только человек, который находится вне науки.

"Адам" или "хромосомный Адам" - это игровые, примитивные определения для "пипла". В нем как игровом понятии ничего неверного нет, поскольку это концептуальное понятие. Оно плавает с развитием науки. Вы же придаете ему начетнический смысл, пытаетесь фиксировать его в пространстве и во времени, считаете мутации до него, настаиваете, что он жил в Африке. А настаиваете потому, что это некритически написали авторы учебника - "Адам хромосомы Y’, жил тоже примерно 200.000 лет назад в Африке". А раз вы принимаете это за непреложную истину, то вы туда же, потому что не хотите или не умеете думать и сравнивать.

А на самом деле этот "Адам" просто не мог быть негроидом, хотя бы даже потому, что негроидами не были неандертальцы. А они - относительно близкие наши родственники. Уже ясно, что негроиды - это совершенно отдельная ветвь развития Homo sapiens, хотя постоянно смешивается и разбавляется. Если вы посмотрите на разницу в мутациях неафриканцев (ВТ, она же бета-гаплогруппа) и А0, вы поймете (хотя вряд ли), какая там разница. На гаплотипы вы тоже смотреть не хотите и не умеете. Вы не хотите видеть, какая разница в аллелях между гаплогруппами А, А0, ВТ в "сверхмедленных" 22-маркерных гаплотипах. Именно потому у вас отсутствует научный подход. Потому вы вывели себя за границы науки.

В любой науке люди работают на 4-8 лет (как минимум) впереди учебников. Учебники - не для науки, а для обучения студентов. Если бы на любом научном семинаре кто-то стал апеллировать к учебникам, его бы на смех подняли. Да такого и быть не может, если только апеллирование к учебнику дается на что-то давно известное и устоявшееся. А вы на учебник серьезно ссылаетесь, в котором авторы дали маху. Потому вы и выводите себя за пределы науки.

Вот, например:

Просто это у них были первоначальные последовательности DNA митохондряльнэ и хромосомы Y, от которыx происходят все последовательности у живущих теперь людей

Когда авторы учебника это писали, они не имели понятия, что будет обнаружена архаичная линия А0. Ну и где там "все последовательности у живущих теперь людей"? Нет их. Не знаете об этом? Поэтому или общий предок вашего "Адама" и А0 уходит значительно ниже "Адама", и вся конструкция ломается, или сам "Адам" уходит куда-то вниз, а куда - пока неизвестно

.

Автор: Igor1961 16.10.2012, 18:30

Однако, по имеющимся на настоящий момент оценкам, точка пересечения "клана Перри", ветви А0 с делецией в DYS425 и альфа-гаплогруппы уходит где-то на 200 тысяч лет назад, по порядку величины. Это очень давно, но все же существенно позже, чем время, когда разошлись пути современного человека и неандертальца, если верны расчеты, сделанные по аутосомам. Так что в этом контексте речь идет о каких-то более поздних в сравнении с неандертальцем, не говоря уж о шимпанзе, архаичных формах'

Кстати, в http://www.pnas.org/content/early/2011/08/29/1109300108 М. Хаммер с соавторами как будто бы нашли в геномах африканцев следы гибридизации с каким-то неизвестным архаичным видом, но неясно, насколько аккуратна была численная модель, которую они использовали для сравнения СОВРЕМЕННЫХ геномов.

P.S. К сожалению, дискуссия в этой теме постоянно тонет в многословных рассуждениях некоторых участников о каких-то частностях и условностях, которые явно не стоят такого внимания. Ну, что принципиально изменится, если один из нескольких десятков снипов кто-то как-то не так отнес? Или еcли повторять, как мантру: Perry - root- Adam - Cruciani? Схоластика какая-то, а не наука. Прямо как изучение философии в достопамятные времена, когда упор делался не на то, что внес в наше понимание мира тот или иной мыслитель, а на то, какую этикетку ему приклеить - идеалист или материалист

Автор: aklyosov 16.10.2012, 20:17

Цитата(Igor1961 @ 16.10.2012, 10:30) *
Однако, по имеющимся на настоящий момент оценкам, точка пересечения "клана Перри", ветви А0 с делецией в DYS425 и альфа-гаплогруппы уходит где-то на 200 тысяч лет назад, по порядку величины. Это очень давно, но все же существенно позже, чем время, когда разошлись пути современного человека и неандертальца, если верны расчеты, сделанные по аутосомам.


Не в том дело. Еще недавно за эту точку принимали 70 тыс лет назад, потом 100, потом 140, потом 160. сейчас 200 тысяч лет назад. А обследовали какую-то то ничтожную долю процента африканцев, человек 200 из 200 миллионов. Там еще искать и искать, и я не удивлюсь, если этот концептуальный "Адам" опустится на 500 тыс лет назад, а то и глубже, древнее неандертальца.

Дело опять же не в том, когда жил неандерталец и были ли верны расчеты по аутосомам, а в том, что он не был негроидом. Тогда получается, что негроидность или вообще древнее нендертальца, или, напротив, образовалась относительно недавно, уже после расхождения неандертальца с будущим хомо сапиенс. Но тогда еще яснее. что мы не произошли от негроидов, какие комбинации ни строить. А поскольку решения этого вопроса нет, всякая эта суета с "Адамом" лишена всякого смысла. То есть его можно хоть горшком назвать, но решения проблемы это не приближает.

Автор: Aero 21.10.2012, 0:38

Цитата(aklyosov @ 4.10.2012, 13:48) *
Нет никакого четкого консенсуса, что такое "сапиенс", есть целое облако признаков, которые порой противоречат друг другу. Есть много спорных вариантов отнесения древних костей к "сапиенс" или "не совсем сапиенс", или "не сапиенс". То же и о скрещивании. Я бы не стал оперировать голыми схемами в таких спорных вопросах.

То ж и о видах. Виды не скрещиваются, но новые виды появляются. С кем они, новые, скрещиваются?

Я уже как-то говорил об этом тоже. И даже предлагал привлечь Homo heidelbergensis. Тогда был ответ, от уважаемой Людмилы - что существует период неполного разделения ветвей.

Я вот думаю - ведь практически, не применяется термин - расы, по отношению к животным. Там - породы, например, пусть даже полученные в результате искусственной селекции. Они скрещиваются.

Раса - и есть естественные породы, в периоде неполного разделенния видов. Они должны быть и у животных, обязательно, иначе не будет видообразования.

Причем расообразование, представляется мне очень шаткой системой, в которой вид из расы, не обязательно выделится полностью, хотя раса может существовать n-ное время самостоятельно, с сохранением возможности скрещивания с родительской ветвью, но со временем может редуцироваться.

Если же вид выделился, из родительской ветви, то существует возможность скрещивания допустим с другой расой, имеющий некое промежуточное положение между братскими видами, которая будет сохранять статус расы для обоих видов.

Из этого следует:
1. Если все же окончательно докажут факт скрещивания сапиенсов с неандертальцами - то неандертальты теряют статус вида, и получают статс расы.
2. Либо, в самом "лагере" неандертальцев, как отдельного вида, придется признать наличие рас, некоторые или одна из которых (например морфологически более близкая к нам), имела возможность скрещивания с сапиенсами. Т.е была и расой сапиенсов.
3. То же по неграм rolleyes.gif Что собственно на сегодня и имеем. Негроидную расу. Отдельный негроидный вид (существующий сегодня) - не зафиксирован.

Автор: Aero 21.10.2012, 13:18

Цитата(bugler @ 4.10.2012, 18:09) *
Вот и меня это смущает. Потому что получается жил некий примат с приматкой, бац и шимпанзе получилось. Ещё пожили - бац и кроманьонец. А шимпанзе кроманьонцу не брат...Наверняка образование нового вида это сложный и длительный процесс, где намешивается куча тупиковых вариантов. И только после этого начинает работать хромосомная защита "свой-чужой".


Я думаю, в основном они не тупиковые. Они редуцируются обратно в основной эволюционный ствол, естественно с сохранением (и обогащением его) накопленных собственных признаков. И эти признаки рассматриваются уже как собственные. И по этой причине чужие "улетают" сразу далеко во времени. Хотя некоторые и тупиковые варианты возможно есть.

Кроме того, так же как вылазят все более древние ветви сапиенсов, возможно должны быть и более близкие нам неандертальские мито-линии. Там статистики вообще мало.

Автор: Stanislaw 12.11.2012, 9:48

Американцы (dr M. Hammer) объявили вообще о сенсационном открыть наиболее старой ветви вспульчэснэго человека.
Теперь (по новым правилам для расчета) врэмя Адама 338.000 лет !
Объявили, что во FTDNA от сегодняшнего дня можно будет тестировать SNP Перри.


Автор: Igor1961 12.11.2012, 11:29

Цитата(Stanislaw @ 12.11.2012, 15:48) *
Американцы (dr M. Hammer) объявили вообще о сенсационном открыть наиболее старой ветви вспульчэснэго человека.
Теперь (по новым правилам для расчета) врэмя Адама 338.000 лет !
Объявили, что во FTDNA от сегодняшнего дня можно будет тестировать SNP Перри.

А что это за новые правила, если не секрет? Если имеется в виду "клан Перри", то у сенсации уже отросла приличная борода. Мы об этом уже года полтора знаем.

Может быть, теперь рассекретят все снипы Перри? Совсем ведь некрасиво получается - люди заплатили свои деньги за WTY (как понимаю, это Вы и Ваши родственники), и ни ответа, ни привета! В современном русском языке это называется "кинуть".

Автор: Stanislaw 12.11.2012, 12:28

Цитата(Igor1961 @ 12.11.2012, 11:29) *
Цитата(Stanislaw @ 12.11.2012, 15:48) *
Американцы (dr M. Hammer) объявили вообще о сенсационном открыть наиболее старой ветви вспульчэснэго человека.
Теперь (по новым правилам для расчета) врэмя Адама 338.000 лет !
Объявили, что во FTDNA от сегодняшнего дня можно будет тестировать SNP Перри.

А что это за новые правила, если не секрет? Если имеется в виду "клан Перри", то у сенсации уже отросла приличная борода. Мы об этом уже года полтора знаем.

Может быть, теперь рассекретят все снипы Перри? Совсем ведь некрасиво получается - люди заплатили свои деньги за WTY (как понимаю, это Вы и Ваши родственники), и ни ответа, ни привета! В современном русском языке это называется "кинуть".

Статья еще неопубликованная.
Но может быть объявят на finch-2 результаты WTY Perry.
Датировку установили на основании теста почти всего Y-DNA (это наконец!).
......
К некоторым инициаторам и дарителям вступительных изучении неофициальные поздравления из Америки уже пришли.

Автор: aklyosov 12.11.2012, 15:39

Цитата(Stanislaw @ 12.11.2012, 1:48) *
Американцы (dr M. Hammer) объявили вообще о сенсационном открыть наиболее старой ветви вспульчэснэго человека.
Теперь (по новым правилам для расчета) врэмя Адама 338.000 лет !
Объявили, что во FTDNA от сегодняшнего дня можно будет тестировать SNP Перри.


biggrin.gif

Я не имею понятия, что это за "новые правила для расчета", но Хаммер для меня лично по "новым правилам" вовсе не авторитет. Я прекрасно помню, как он везде совал "новые правила" расчетов "по Животовскому", и как я его слегка "понес" в журнале Human Biology, и как он опозорился с ответом. Так что эти "новые правила" надо еще как проверять.

Хотя я вполне допускаю, что у Хаммера появился толковый студент, работу которого сейчас и подают как "Хаммер объявил". Может быть. Но "время Адама" как 338 тысяч лет впечатляет своей необыкновенной точностью, из чего уже можно видеть, что перед нами, скорее всего, очередная туфта. Толковый студент написал бы "примерно 340 тысяч лет".

Но мне интересно другое - как быстро наш приятель Stanislaw меняет свои воззрения, причем избирательно. Мы ему тут столько толковали, что время жизни общего предка с учетом А0 не менее 200 тысяч лет, и даже, возможно, не менее 260 тысяч лет, но он не воспринимал. Вместо этого везде сообщал, и у нас, и на RootsWeb, и на MolGen о своей смешной цифре 108 тысяч лет (или что-то в этом духе). Но стоило Хаммеру оповестить о другой цифре, как наш приятель с восторгом уже об этом сообщает. 108 тысяч лет уже с восторгом забыты, как и "методология" своих расчетов.

Забавно.

Поневоле вспоминаешь слово "флюгер".

Автор: Люда 12.11.2012, 15:50

Цитата
Вместо этого везде сообщал, и у нас, и на RootsWeb, и на MolGen о своей смешной цифре 108 тысяч лет

Еще и брал наши наработки по предковым снипам и нес их на
http://eng.molgen.org/viewtopic.php?f=6&t=47
не указывая, откуда они.

Автор: казак 12.11.2012, 22:13

Что то я не понял - а папу Адама относят к кому? Видимо вопрос в формулировке - что за развилка в 340 000 лет?

Автор: kosmonomad 12.11.2012, 22:21

Цитата(казак @ 12.11.2012, 23:13) *
Что то я не понял - а папу Адама относят к кому? Видимо вопрос в формулировке - что за развилка в 340 000 лет?

Обнаружился некий Perry, года полтора назад, у которого общий предок с остальным человечеством в промежутке 260000 - 400000 лет или около 340 тлн.

Вся ветка выше это обсуждает.

Хаммер и Станислав очевидно считали по количеству снипов Y-ДНК.

Автор: Люда 12.11.2012, 22:47

http://prezi.com/kz2c-q4b-_m1/a00-on-the-y-haplogroup-tree/
Здесь можно посмотреть презентацию по Новому Древу с ветвью А00.
Ветви идут параллельно. Часть снипов, от первоначально заявленных как Перри, перенесены в ветвь остального человечества (в А0Т), как мы здесь и определяли еще в мае месяце. Отличие от шимпанзе в 1109+54 (?) у А00 и 1109+164(?) у А0Т. Т.е. наверно в дополнение к выявленным снипам Перри просеквенировали его всю хромосому и посчитали количество отличий от шимпанзе и гориллы (2084+27 3-аллельных снипа). Количество мутаций умноженное на частоту мутирования и дало возраст (я так понимаю).

 

Автор: aklyosov 13.11.2012, 1:22

Цитата(казак @ 12.11.2012, 14:13) *
Что то я не понял - а папу Адама относят к кому? Видимо вопрос в формулировке - что за развилка в 340 000 лет?


Да ни к кому они его не относят. У этих попгенетиков игра в перетягивание каната - кто древнее по любым промежуточным данным - тот и Адам. Ничего научного в этом понятии нет.

А ничего научного нет - потому что надо отдельно, специально и надежно показать, что найден общий предок ВСЕХ ныне живущих (мужчин) на планете, а не только Перри. С какой это стати предок Перии вдруг автоматически становится общим предком всех людей? Да в Африке этих Перри под каждым кустом... А если еще на баобабах посчитать... Короче, сейчас этих Перри смотрят только среди немногих протестированных афро-американцев в США, да и то протестированных за их собственные деньги. А в Африке ни у одного длинных гаплотипов не тестировали, академическая наука их не рассматривает. Вот когда начнут африканцев сниповать, тогда эти Перри валом пойдут, и сам Перри может оказаться просто мальчиком по возрасту по сравнению с другими. А Stanislaw уже с криками Адам! бегает по окрестностям.

Пока имеем наскидку следующее. Общий предок неафриканцев, живущих в настоящее время, жил примерно 64 тысячи лет назад. Отдельной ветвью идут носители гаплогруппы А, которая представляет собой зонтик гаплогрупп, с общим предком примерно 120 тыс лет назад (не считая еще одного зонтика - А0). Эти две ветви имеют общего предка 160 тыс лет назад.

Помимо них идет зонтик гаплогрупп, пока условно называемых А0, который по Y-хромосоме идет параллельно двум другим, и по немногим доступным длинным гаплотипам (ни одного настоящего африканца из Африки) ужодит вглубь как минимум на 180 тысяч лет, по ранним нашим данным - на 260 тыс лет. Ясно, что это не предел, и будем много раз уходить все глубже и глубже. Никакой это не Адам, называть так - это детский сад, что есть на самом деле профанация.

Теперь по новой цифре. Я за нее не дам и ломаного гроша. Как написал Stanislaw, которому веры тоже нет - что они считали по всему геному, а не по Y-хромосоме. Есть на самом деле такой подход, но он не калиброванный, константы скорости мутации каждый предлагает свои, опять же не калибруя, или "калибруя" по приматам, довольно произвольно назначая им возрст. При этом масса допущений, многие с потолка. Ничего в этом страшного или неправильного нет, наука развивается. Неправильно - это когда бегают и объявляют, что вот это-то и есть правильные данные, "посчитанные по новым правилам". Угу.

Надо сначала разобраться, что это за "новые правила", что в их основе, как считали и как и по чему калибровали. По гаплотипам Перри никак не получится 340 тысяч лет до общего предка с другими африканцами или с европейцами, там нет стольких мутаций. Для 340 тысяч лет нужно, чтобы разница между 22-маркерными гаплотипами Перри и R1a была 32 мутации, а их там на самом деле 25 мутаций. Это для 22-маркерных гаплотипов - огромная разница. Получается, что если А0 для Перри возрастом 160 тысяч лет, то их общий предок с R1a жил 200 тысяч лет назад. А с 340 тыс лет для предка Перри вообще ничего не получается при разнице в 25 мутаций.

Так что, как говорил хрестоматийный герой филима - "У меня закрадываются смутные подозрения...".

Автор: aklyosov 13.11.2012, 1:36

Цитата(Люда @ 12.11.2012, 14:47) *
Количество мутаций умноженное на частоту мутирования и дало возраст (я так понимаю).


В том-то и фокус. Количество мутаций посчитать можно, хотя там свои нюансы, а вот "частоту" надо знать и калибровать по надежным источникам. По Y-хромосоме работает величина одна миллиардная на нуклеотид (base) за год. А вот по всему геному - кто во что горазд. Кто на два умножает, кто на три, кто на четыре. Вот и Хаммер на что-то умножил.

Автор: Люда 13.11.2012, 6:50

Отличие от шимпанзе в 1109+54 у А00 и 1109+164 у А0Т. Немного странно, если на участке (точно не помню, на каком первоначально нашли снипы Перри) ну, на каком-то ограниченном, разное количество мутаций, а другая цифра-1109 одинаковая. Не поняла, это по Y наверно? Если никаких дополнительных к тому, что было уже, различающих 2 линии мутаций нет, то 54 против 164. Значит Перри отделился позже от шимпанзе, наша линия старше.

Автор: казак 13.11.2012, 12:36

Значит Перри отделился позже от шимпанзе, наша линия старше.

С другой стороны, разветвление человека (без Перри) с шимпанзе 6 млн. лет. - это значит, что и линия Перри будет стремиться к этой дате?

Практически получаются как минимум 2 центра развития с миллионными возрастами. Если: Африканский слон, Индийский слон, вымерший 200 000 лет назад Индонезийский и под временным вопросом Кавказский - это значит количество центров развития как минимум уже 4. (Выходцы из африки говорят? ну ну))))


Автор: kosmonomad 13.11.2012, 13:27

Цитата(Stanislaw @ 12.11.2012, 13:28) *
Но может быть объявят на finch-2 результаты WTY Perry.
Датировку установили на основании теста почти всего Y-DNA (это наконец!).
......
К некоторым инициаторам и дарителям вступительных изучении неофициальные поздравления из Америки уже пришли.

Только поясните, пожалуйста. Прочитали ему всю Y? По новой технологии или как? И как считали, как Вы и раньше здесь выкладывали цифры: по количеству снипов Y?

Автор: aklyosov 13.11.2012, 15:57

Цитата(В.Юрковец @ 13.11.2012, 7:09) *
Резьба не выдержала...


Да уж... Долго сидел в засаде, все думал, на кого выплеснуть.

И что характерно для таких нервных, своего ответа, конечно, не дал. Такие ответов не дают, для них главное не ответ дать, а выскочить из засады и куснуть.

Пришлось отправить в помойку.

Автор: aklyosov 13.11.2012, 16:07

Цитата(Люда @ 12.11.2012, 22:50) *
Отличие от шимпанзе в 1109+54 у А00 и 1109+164 у А0Т. Немного странно, если на участке (точно не помню, на каком первоначально нашли снипы Перри) ну, на каком-то ограниченном, разное количество мутаций, а другая цифра-1109 одинаковая. Не поняла, это по Y наверно? Если никаких дополнительных к тому, что было уже, различающих 2 линии мутаций нет, то 54 против 164. Значит Перри отделился позже от шимпанзе, наша линия старше.


Уважаемая Людмила,

Думаю, столь прямолинейные выводы здесь вряд ли применимы. У Перри столько отличий от нас по снипам, что такое сопоставление типа "моложе"-"старше" без принятия их в расчет не работает. У него просто другая линия, которая ушла от шимпанзе намного, а значит, видимо, находится ближе, чем мы, к общему предку нас с шимпанзе. Значит, получается уже старше, чем мы. Далее, там могут быть дополнительные усложнения по выбору, что с чем сравнивать, в общем, эти подходы по снипам пока недоработаны. Не случайно мы видим, как прыгают эти данные и выводы по снипам.

Автор: Люда 13.11.2012, 17:08

Прикрепляю DYSы из презентации. Далеко не везде совпадает с нашими рассчетами. В некоторых случаях, как DYS472, они считали все гомологичные триплеты, получилось у шимп.16. Мы решили считать только строго гомологичные послед-ти, получилось 5.
Chimpanzee (Y-chromosome):
AGATTGTCCCACCTGCACTCCAGCCTGGCG
ACACAGGAAGGTTCCATCTCAAATAGTAAT
AATAATAATAAT
GATAATAATAATAGTAAT
AATAATAATAATAATGCCTCTT

 

Автор: Люда 13.11.2012, 18:55

Прошлась по DYSам, которые мы смотрели. Прикреплю несколько сюда повторно (все уже было в разных темах).
DYS388 ATT 15 повторов у шимп., как мы и считали. В презентации-12.
DYS426 у нас 8, у них 10 GTT. 10 получится, если считать так: 2 GTT, потом 5 T, потом 8 GTT.
DYS 392 у нас 10, там - N (не найден? или не указан в Табл?), таких маркеров много - 455, 454, 531,590.В некоторых случаях эта N соответствует нашему - Нет гомологии.
В случае DYS472 наверно мне надо было настоять на 16 (по принятой классификации), нашла наше обсуждение здесь:

Цитата
Цитата
DYS472=taa. У чел.8, у шимпанзе 5(taa)+tga+3(taa)+tag+6(taa) Yхр. У шимпанзе в этом районе встроены лишние 24 буквы по сравнению с человеком. Поэтому затрудняюсь сказать, как считать. Если строго, то наверно до 1ого сбоя, т.е.5(taa) (?)

По ссылке, приведенной Боромиром, получается, что в данном случае считать нужно все повторы, т.к. количество нуклеотидов, их разделяющее, не больше повторяющегося мотива.

В сумме по тем снипам, что мы считали картина соответствия такая:
DYS Chimp(Prez) A00(Prez) Сhimp(наши рассчеты)
388 12 11 15
426 10 13 8
392 N 12 10
455 N 10 4
454 N 11 N
438 5 16 5
531 N 10 N
578 5.1 9 9
590 N 8 N
472 16 8 5
425 N 9 10
594 * (?) 12 4
436 * 11 4
490 N 12 7
450 N 8 N
617 N 12 4
568 N 12 4
640 12 11 8
492 10 11 9
641 10 8 10

 

Автор: Igor1961 13.11.2012, 19:04

Наверное, интересно будет сравнить гаплотип шимпанзе в презентации Томаса Крана и тот, что мы определили из европейской ДНК-базы. Слева - нвши данные, справа - Томаса. С случае сверхмедленных маркеров DYS426 и DYS472 красным помечен фрагмент, который считали мы, синим - то, что, возможно, добавил к ним Томас:

DYS426 8 10 TTTTTTGTTGTTGTTGTTGTTGTTGTTGTT
DYS388 12 15
DYS392 10 N/A
DYS455 4 N/A
DYS454 N/A N/A
DYS438 5 5
DYS531 N/A N/A
DYS578 9 5.1
DYF395S1a N/A *
DYF395S1b N/A *
DYS590 N/A N/A
DYS641 10 10
DYS472 5 16 AATAATAATAATAATGATAATAATAATAGTAATAATAATAATAATAAT
DYS425 10 N/A
DYS594 4 4.1
DYS436 4 *
DYS490 7 N/A
DYS450 N/A N/A
DYS617 4 N/A
DYS568 4 N/A
DYS640 10 12
DYS492 9 10

В остальных маркерах, где наблюдаются разночтения, повторяющиеся последовательности у нас читались однозначно, без вариантов. Не думаю также, что Томас что-то мог напутать, с его-то опытом. Так что остается предположить, что он анализировал образец, взятый у другого шимпанзе.

Если это действительно так, то эти 2 гаплотипа различаются на 7 мутаций на 7-ми маркерах, если округлить дробные аллели в бОльшую сторону, как это делается в стандартной таблице FTDNA, и считать "перебои" в последовательностях в 2-х проблемных маркерах так, как показано в таблице. То есть, это тот же порядок времен, что разделяет альфа- и бета-гаплогруппу. Думаю, вполне разумная величина для приматов.

Автор: Igor1961 13.11.2012, 19:06

Упс, продублировал сообщение уважаемой Людмилы. unsure.gif Надо бы их как-то скомпоновать.

Автор: Люда 13.11.2012, 19:11

Я не совсем правильно написала, там где не нашла данные, теперь дорылась. Внесу изменения в ту Табл.

Автор: Igor1961 13.11.2012, 19:26

Цитата(Люда @ 14.11.2012, 1:11) *
Я не совсем правильно написала, там где не нашла данные, теперь дорылась. Внесу изменения в ту Табл.

А почему Вы не дописали до конца маркеры Перри? Кстати, в презентации дается ссылка на его гаплотип в более удобном для обработки виде, http://www.ysearch.org/search_view.asp?uid=6m5ja&viewuid=6M5JA&p=1. Есть YSearch есть также также 25 маркеров http://www.ysearch.org/search_view.asp?uid=6rcuu&viewuid=6RCUU&p=1 (cell line Coriell NA03448) и 25 - http://www.ysearch.org/search_view.asp?uid=9ed3a&viewuid=9ED3A&p=1, без указания источника.

Автор: Люда 13.11.2012, 19:31

Cтранно, конечно. Вряд ли эти приматы дальние родственники. В некоторых случаях, как DYS472, мы наверно отступили от номенклатуры. А вот DYS426 по этой номенклатуре будет 8, а не 10, т.к. вклиниваются 5Т, это больше мотива-GTT, значит нельзя суммировать. DYS578 что означает 5.1? Там четко 9 АААТ.

Автор: aklyosov 13.11.2012, 19:59

Цитата(Люда @ 13.11.2012, 9:08) *
Далеко не везде совпадает с нашими расчетами. В некоторых случаях, как DYS472, они считали все гомологичные триплеты, получилось у шимп.16. Мы решили считать только строго гомологичные послед-ти, получилось 5.
Chimpanzee (Y-chromosome):
AGATTGTCCCACCTGCACTCCAGCCTGGCG
ACACAGGAAGGTTCCATCTCAAATAGTAAT
AATAATAATAAT
GATAATAATAATAGTAAT
AATAATAATAATAATGCCTCTT


Вот именно я это и имел в виду, что там много нюансов, и расчеты не получаются однозначными. Поэтому надо в первую очередь смотреть на "концептуальные" выводы, а не на схоластику.

Вот давайте и посмотрим. У практически всех людей DYS472=8, и это строго гомологичная последовательность триплетов AAT. У шимпанзе их DYS472=5 в строго гомологичной последовательности. Константа скорости мутации DYS472 примерно 0.00001, то есть одна мутация в среднем на 100 тысяч поколений, или одна мутация в 2.5 миллионов лет. По строгой гомологии имеем разницу с шимпанзе в три мутации, то есть примерно 7.5 миллионов лет, да три мутации в одном маркере добавят поправку на возвратные мутации. Понятно, что три мутации - это не строгая статистика, но суть уже видна - цифра разумная.

Надо, кстати, заметить, что эта принятая цифра для числа аллелей у человека, DYS472=8, не включает еще два триплета ААТ, один из которых отделен от гомологичной последовательности четырьмя другими нуклеотидами (ТАGT), и один вообще за версту от них (а именно, на 52 нуклеотида в стороне). То есть заметьте - считаем только строго гомологичные последовательности.

Теперь смотрим на то, что считали "они" - 16 мутаций у шимпанзе, а не 5, как мы считали. При этом засчитали и тот триплет, который у шимпанзе отделен точно такими нуклеотидами - TAGT, и тот, который за 52 нуклеотида. Хорошо ли это? У человека, выходит, это не считаем, а у шимпанзе засчитали. Помимо того, у шимпанзе в общую кучу накидали еще 9 ААТ, которые в гомологию не входят. То есть получили суммарно 16 (!) АТТ. Различие с человеком - 8 мутаций в DYS472, то есть не только 2.5х8 = 20 миллионов лет разницы, плюс добавят возвратные мутации. Иначе говоря, 16 мутаций в DYS472 у шимпанзе - цифра совершенно нереальная. От того, что повторять про опыт Томаса, во рту слаще не станет.

Поэтому не стоит сразу хватать "их" данные и автоматически исходить из того, что они правильные. Опыт уже научил нас, что это скорее не так, чем так. Давате все-таки критичнее смотреть на вещи, и включать не слепое заимствование, а осмысление альтернативных интерпретаций. В этом суть науки и научного подхода.


Автор: Люда 13.11.2012, 20:18

Я "их" не хватаю и на все несообразности указываю. Я просто поняла, как они считали DYS472 - по принятой номенклатуре - 5(taa)+tga+3(taa)+tag+6(taa).

Цитата
При этом засчитали и тот триплет, который у шимпанзе отделен точно такими нуклеотидами - TAGT, и тот, который за 52 нуклеотида.
Это что-то другое.
А вот DYS426 по этой номенклатуре будет 8 (как у нас), а не 10.

 DYS472.doc ( 24 килобайт ) : 132
 

Автор: aklyosov 13.11.2012, 20:20

Цитата(Люда @ 13.11.2012, 12:18) *
Я "их" не хватаю...


Я не про Вас лично это писал. Заметьте, Вашего имени там нет. Не стоит сразу примерять на себя. Это скорее к Stanislaw относилось, но и его имени я не указал. Зачем?

Автор: aklyosov 13.11.2012, 20:27

Цитата(Люда @ 13.11.2012, 12:18) *
Я просто поняла, как они считали DYS472 - по принятой номенклатуре - 5(taa)+tga+3(taa)+tag+6(taa).
Цитата
При этом засчитали и тот триплет, который у шимпанзе отделен точно такими нуклеотидами - TAGT, и тот, который за 52 нуклеотида.
Это что-то другое.


Ну если это "что-то другое", то они НЕ считали по "принятой номенклатуре".

Я не устаю все время повторять - надо анализировать данные САМИМ, а не настраиваться ментально, что у "них" якобы все правильно, а у "нас" неправильно. Очень часто получается наоборот.

А если у нас неправильно - тоже хорошо, есть возможность повысить свой уровень понимания. Только к этому "неправильно" надо приходить самим, а не потому, что у "них" по-другому. Вот я только что и показал, что DYS472=16 не имеет смысла. Вообще там появление второго прогона ТАА подозрительно похоже на однократное копирование всей гомологии, а это тогда одна мутация, а не много. В общем, на Ваших двух примерах уже видно, что "они" завышают число мутаций.

Автор: aklyosov 13.11.2012, 20:31

Цитата(aklyosov @ 13.11.2012, 7:57) *
Цитата(В.Юрковец @ 13.11.2012, 7:09) *
Резьба не выдержала...


Да уж... Долго сидел в засаде, все думал, на кого выплеснуть.

И что характерно для таких нервных, своего ответа, конечно, не дал. Такие ответов не дают, для них главное не ответ дать, а выскочить из засады и куснуть.

Пришлось отправить в помойку.


Шоломич, как я вижу, опять удален. Его среднее время жизни здесь меньше, чем политрука на передовой. Только причина диаметрально противоположная.

Не может он нормально общаться в коллективе. Вот такая "загогулина". Сам-то он это понимает, интересно?

Автор: Павел Шварев 13.11.2012, 20:38

Цитата
Его среднее время жизни здесь меньше, чем политрука на передовой.

Братья и сестры, до конца света осталось меньше 40 дней, и незачем их тратить на пустопорожний лай.
Аминь http://smayliki.ru/smilie-1028002599.html

Автор: aklyosov 14.11.2012, 2:18

Цитата(Павел Шварев @ 13.11.2012, 12:38) *
Братья и сестры, до конца света осталось меньше 40 дней, и незачем их тратить на пустопорожний лай.


Уважаемый Павел, про лай - этo Вы Шоломичу сообщите. Люди здесь работают, загадки природы разгадывают, а он как чумовой сегодня выскочил. Как арии говорили - "як скаженный".

А что, через 40 дней опять свет отключают?


Автор: Боромир 14.11.2012, 4:51

Цитата(Igor1961 @ 13.11.2012, 11:26) *
...Есть YSearch есть также также 25 маркеров http://www.ysearch.org/search_view.asp?uid=6rcuu&viewuid=6RCUU&p=1 (cell line Coriell NA03448) ...

Цитата(Люда @ 13.11.2012, 11:31) *
Cтранно, конечно. Вряд ли эти приматы дальние родственники.

В YSearch ID http://www.ysearch.org/search_view.asp?uid=6rcuu&viewuid=6RCUU&p=1 депозитированном Томасом Краном, как шимпанзе указан вид Pan paniscus. А это http://en.wikipedia.org/wiki/Pan_paniscus.

По Дэвиду Райху бонобо и шимпанзе (обычный) разошлись http://www.plosgenetics.org/article/info:doi/10.1371/journal.pgen.1000057?imageURI=info:doi/10.1371/journal.pgen.1000057.t001 лет тому назад. Этот расчет сделан из предположения, что человек и шимпанзе разошлись 7 000 000 лет тому назад.
Цитата
We caution that all these date estimates have systematic uncertainty as they are obtained by assuming that human-chimpanzee autosomal genetic divergence averaged 7 May [12] (Materials and Methods).


Очевидно, что СТРы разных видов не должны совпадать.

Поскольку геном бонобо не депозитирован в базы данных (не смог найти), то Кран скорее всего прочитал обезъянью ДНКу, используя человеческие праймеры. Ещё ряд косвенных наблюдений указывает на то, что у Крана СТРы шимпанзе получены экспериментально, а не рассчитаны.
Во-первых, на рисунке в его презентации некоторые СТРы (и обезъяньи и человеческие) имеют дробные значения, но затем одинаково показаны целочисленными в YSearch IDs. Во-вторых, Кран не увидел многие СТРы, которые на кончике пера экстрагировала из генома обычного шимпанзе Людмила Евгеньевна, что легко объясняется возможными мутациями в праймерах (это ведет к нуль мутациям). И, наконец, на презентационных картинках шимпанзе бонобо и горилле присвоены GRC (Genome Reference Consortium) номера GRC12083606 и GRC12083607 близкие к номеру родственника Перри GRC12088164 - это указывает на то, что их взяли в работу вскоре друг за другом (обезъяньи позже, когда потребовалось). Для сравнения, мне был присвоен почти два года назад GRC020713.

Автор: Боромир 14.11.2012, 4:53

Цитата(aklyosov @ 13.11.2012, 18:18) *
А что, через 40 дней опять свет отключают?
smile.gif
Многие замерли в ожидании.

Автор: Люда 14.11.2012, 5:53

Cпасибо, Боромир. Похоже, что это так и есть. Тогда становятся понятны расхождения.

Автор: Люда 14.11.2012, 10:03

Хочу попросить тех, кто имеет доступ к просмотру сиквенсов на FT, скопировать последовательность Перри в области DYS472 (если это возможно). Хочу посмотреть, как у него считали - 8. У гориллы 6.

Автор: Боромир 14.11.2012, 15:45

Цитата(Люда @ 14.11.2012, 2:03) *
Хочу попросить тех, кто имеет доступ к просмотру сиквенсов на FT, скопировать последовательность Перри в области DYS472 (если это возможно). Хочу посмотреть, как у него считали - 8. У гориллы 6.

Доступа к сиквенсам СТРов нет как у рядовых пользователей, так и у админов проектов. Это сугубо инсайдерская информация компании.

Автор: aklyosov 14.11.2012, 16:12

В нашей статье, которая вот-вот будет опубликована, мы насчитали от шимпанзе 52 мутации до альфа-гаплогруппы, и 92 мутации до А0 (это по данным от июня этого года). Число мутаций между А0 и альфа-гаплогруппой было 56, плюс еще 21 мутация до бета-гаплогруппы.

Но эти цифры все, конечно, в прогрессе, поэтому по ним вряд ли можно что считать.

Бонни Шрак в своем докладе на прошлой неделе уже оперировала другой номенклатурой - А0 (переименованной, по-моему, из А1b) и А00, и А0-Т. Она объявила, что между "Адамом" и А00 имеется 50 мутаций (SNP). По ее мнению, от А0-Т дерево расходится на А0 и А1, иначе говоря, А0 и А1 находятся на одном филогенетическом уровне. От "Адама" до А0-Т - 30 мутаций. Между А00 и А0-Т нет общих мутаций. От А0-Т до А0 - 38 мутаций. От А0 отходят А0а и А0b. От А0-Т до А1 - 20 мутаций, все они есть в ВТ сводной гаплогруппе, и, следовательно, во всех неафриканцах.

Примечание - по нашему счету на июнь 2012 между альфа-гаплогруппой и ВТ было 21 мутация. Так что "они" названия меняют, у нас они остаются теми же. В этом и смысл понятия "альфа-гаплогруппа", не надо все время переименовывать.


Автор: Павел Шварев 14.11.2012, 16:20

А что, через 40 дней опять свет отключают?http://smayliki.ru/smilie-681391719.html
Ага, отключат по майскому расписанию.

Автор: Люда 15.11.2012, 10:07

Накарканный конец света у меня дома настал, со вчерашнего вечера нет интернета.

Автор: Stanislaw 16.11.2012, 14:38

Новое дерево гаплoгрупы A (в PDF):

http://www.rodstvo.ru/forum/index.php?showtopic=3158#1

http://www.tropie.tarnow.opoka.org.pl/adam_root2012.pdf

Автор: aklyosov 16.11.2012, 16:32

Цитата(Stanislaw @ 16.11.2012, 6:38) *
Новое дерево гаплoгрупы A (в PDF):


Вы продолжаете подтасовывать данные.

Нет никаких А А А от Root, это ваши фантазии. А0 не из каких "А А А" не происходят. Вы могли с тем же успехом поставить Х Х Х, но почему-то считаете, что А - лучше, что это якобы указывает на "Африку". Ничего там не указывает.

Мы все это подробно разбирали, по всем десятков снипов. Есть альфа-гаплогруппа, которая удалена от А0, между ними - десятки снипов. От альфа-гаплогруппы отходят в разные стороны африканская линия и неафриканская линия, бета-гаплогруппа.

Вот-вот на эту тему у нас, трех соавторов, выйдет статья, которая анализирует линии от общего предка с шимпанзе, снипы в шимпанзе, и динамику их образования от "шимпанзе" к А0, к альфа-гаплогруппе и к бета-гаплогруппе. То, что одну из А0 назвали А00, ничего не изменило. Снипы все остались.

Автор: Павел Шварев 16.11.2012, 17:12

У кого нет научного ума те шустро разукрашивают новые области своими преждевременными и глупыми названиями. Это чисто народное наблюдение. Наверное недоумки таким хитрым макаром рассчитывают попасть в "крупные ученые", которых будут вспоминать веками.

Автор: aklyosov 16.11.2012, 18:41

Я не думаю, уважаемый Павел, что Stanislaw это делает с целью стать "крупным ученым". Он прекрасно понимает, что бежать в толпе и выкрикивать "Адам, Адам!" или "Крусиани, Крусиани!", или "Хаммер, Хаммер!" - это не есть путь стать великим. Или даже средним.

Просто он по-другому не может, даже если бы хотел. Он прочитал у нас в свое время про 160 тысяч лет до общего предка, и не отреагировал. Напротив, выражал всяческие сомнения. Но как только Крусиани опубликовал про 142 тысяч лет, Stanislaw возбудился, и не уставал про Крусиани говорить. Видимо, потому что Крусиани использовал магическое слово root, а мы нет.

Далее, мы опубликовали расчеты для общего предка А0 и прочих людей как 260 тысяч лет назад, Stanislaw не отреагировал. Он настаивал на своих 108 тысяч лет, хотя методология не его, он просто ее срисовал. Но как только Хаммер сказал про 348 тысяч лет, Stanislaw опять возбудился. Свои 108 тысяч лет тут же забыты.

То есть для него важна не наука, а некоторые символы. Ему нужны кумиры, как обычно для человека из толпы. А поскольку мы его время от времени критикуем, порой жестко, то кумирами мы уже быть не можем. Крусиани его не критикует, да и вообще не знает о существовании, поэтому он кумир. Правда, сейчас и Крусиани уже забыт, кумиров толпа забывает моментально, как только появляется другой кумир.

Так что к Stanislaw'у стоит относиться спокойно. Мы - не герои его романа, как и он - нашего. Это стало окончательно ясным тогда, когда в ответ на наши слова об архаической линии А0 он объявил, что мы - расисты. У записных либералов это слово близко лежит.

Автор: aklyosov 16.11.2012, 20:55

Цитата(Stanislaw @ 16.11.2012, 6:38) *
Новое дерево гаплoгрупы A (в PDF):

http://www.rodstvo.ru/forum/index.php?showtopic=3158#1

http://www.tropie.tarnow.opoka.org.pl/adam_root2012.pdf


Ну что же, устроим разбор полетов.

Если не придумывать индекса с буквой "А", втайне (или явно) надеясь, что это якобы указывает на ее "африканскую принадлежность", а просто смотреть на снип-мутации между шимпанзе (принимая их за предковые, что не обязательно так, но в первом приближении считаем, что так) и человеком, то мы видим всего несколько вариантов. Эти варианты сводятся к трем:

1) есть некая архаичная линия, назовем ее А0, чтобы не путаться. Там может быть много А0 (что и привело уже к некой А00, потом еще будут А000, А0000 и так далее). Пусть будет некая совокупность архаичных линий А0, с исходным древним предком, но некоторые могли отщепиться и позже.

2) есть альфа-гаплогруппа, которая НЕ ПРОИСХОДИТ от А0.

3) от альфа-гаплогруппа отходят две "параллельные" ветви, одна ведет к одной линии, которые в основном сейчас живут в Африке, другая - к неафриканской линии (бета-гаплогруппа и ее потомки), включающей европейцев. Но даже здесь понятие "неафриканской линии" довольно условно, потому что от нее давно отошла гаплогруппа В, которая в значительной степени (не не полностью) переселилась в Африку.

Как видно, я здесь ухожу от чехарды с индексами, которые постоянно меняются.

Если мы посмотрим на мутации, то увидим, что есть всего несколько основных вариантов при переходе от шимпанзе к людям. Эти варианты такие:

1. В Y-хромосоме есть снип-мутации при переходе от шимпанзе к А0, но мутаций нет при переходе к альфа-гаплогруппе. То есть уже ясно, что А0 - не предковая по отношению к нам, иначе в нас были бы ее снип-мутации. То есть пункт 2) выше уже подтверждается.

2. Нет мутаций при переходе от шимпанзе к А0, но есть мутации при переходе к альфа-гаплогруппе. То есть А0 не происходит от альфа-гаплогруппы. Это линии "параллельные".

Stanislaw на своей схеме раздробил эти простые варианты на несколько, что только запутывает картину.

Итак, посмотрим на варианты.

Итак, мой пункт 1. Тройка "шимпанзе - А0 - альфа" здесь выглядит так:

-- A G A (это снип L529)
-- A T A (L896)
-- C A C (L982)
-- G T G (L984)
-- C A C (L991)

И так далее. В нашей (с И.Л. и Людмилой) статье, которая вот-вот выйдет, таких 92 снипа, которые есть - от шимпанзе - в А0, но нет их в альфа-гаплогруппе. Это в статье таблица 2 и примечания к ней.

А что у Stanislaw'a? У него они идут и в начале, и в конце в конце его картинки, двумя разными блоками. В начале как hg, A00, в конце - как hg, A0. В целом правильно, так можно написать. Непонятно, зачем эти две буквы hg, они ничего не дают, ну да ладно. Он, правда, по ошибке засадил во второй блок L990, которая A A G, то есть там наоборот, мутация в альфа-гаплогруппе, но может, ее уже пересмотрели. То же самое, он засадил в первый блок L1114, которая G G A; L1120, которая G G T; но пропустил почему-то V79, V81, V141, V242. У них всех снип-мутация при переходе от шимпанзе к А0, но нет мутации при переходе от шимпанзе к альфа-гаплогруппе.

Почему эти вполне эквивалентные снип-мутации разделились на А0 и А00 - мне пока остается неизвестным.

Далее, пункт 2. Тройка "шимпанзе - А0 - альфа" здесь выглядит так:

-- G G C (L1089)
-- G G C (L1090)
-- A A G (L1093)
-- G G A (L1114). То есть нуклеотид был G у шимпанзе, остался G у А0, и мутировал в А в альфа-гаплогруппе.
--G G T (L1120)
--C C T (P108)
--G G T (V221)
--G G A (V168)

И так далее. В нашей статье, которая вот-вот выйдет, таких 56 снипов, которые есть - от шимпанзе - в альфа-гаплогруппу, но не от шимпанзе в А0. Это в статье таблица 1.

А что у Stanislaw'a? У него они идут в трех разных блоках, отмеченных как hg A, hg A1, hg A1b. На самом деле это и есть альфа-гаплогруппа. Он думает, что если назвать их "А", то будет похоже на "Африканскую". Более того, он пропустил V21, V29, V41, V54, V59, V64, V161, V168, V171, V174, V203, V221, V235, V238, V241, V250. У них у всех такая же структура, например

-- A A G (V250)
-- C C T (V241)

и так далее.

Какой вывод? А такой, что все прекрасно объясняется без всякого привлечения "африканского происхождения" бета-гаплогруппы, то есть нас с вами. Дерево не укоренено, и этим все сказано.

Если какие-то снипы уже поменялись, просьба сообщить. То, что здесь приведено - по данным на июнь этого года.

Автор: Павел Шварев 16.11.2012, 23:22

Цитата
Я не думаю, уважаемый Павел, что Stanislaw это делает с целью стать "крупным ученым".

Я не брата имел ввиду, а тех клоунов которых он как заводной повторяет.

Автор: aklyosov 17.11.2012, 0:19

Цитата(Павел Шварев @ 16.11.2012, 15:22) *
Цитата
Я не думаю, уважаемый Павел, что Stanislaw это делает с целью стать "крупным ученым".

Я не брата имел ввиду, а тех клоунов которых он как заводной повторяет.


От постоянного повторения становятся такими же. Вот его последнее сообщение на RootsWeb. Некий здравомыслящий ирландец припечатал Stanislaw'a теми же вопросами, какими припечатывали его здесь мы. Он спрсил - какого рожна называть Адамом того каждый раз разного, к которому каждый раз - и каждый раз по-другому - сходятся гаплотипы или снипы? Что нового это дает?

И затем, он спросил - зачем называть вообще Адамом, когда это явно попахивает креацинизмом?

И вообще, что, если появится еще одна новая линия?

И вот что ответил наш тугодумный приятель:

From: <pietrzakstan@poczta.onet.pl>
"Adam" means the MRCA of all currently living humans (see T. Brown, Genomes,
c.19).
"adam" in Hebrew, means 'man'.
If the new line will be, we are also pushing them below Adam :-))
These names are determined by the explorers haplogroup, ISOGG and YCC.

All, Stan

Перевод: "Адам означает TMRCA всех ныне живущих людей" (и приложил ссылку на очередного кумира).

"Адам" на иврите означает "человек" (замечательный аргумент, не так ли? Почему не назвать Кин-дза-дза", что означает "человек" на языке племени мумбо-юмбо? Причем здесь иврит??).

"Если появится новая линия, то мы протолкнем ее ниже Адама" (здесь наш приятель что-то не так перевел).

"Эти имена задали создатели ISOGG и YCC". Тоже замечательный аргумент. Типа раз политрук сказал, значит, так оно и есть.

Автор: Stanislaw 17.11.2012, 0:19

Цитата(Павел Шварев @ 17.11.2012, 0:22) *
Цитата
Я не думаю, уважаемый Павел, что Stanislaw это делает с целью стать "крупным ученым".
Я не брата имел ввиду, а тех клоунов которых он как заводной повторяет.
Я прежде всего всматриваюсь в мутации (SNP), доступное в базах данных.
Они, мутации, регулируют мое мышление, а не идеи или идеологии.

Приветы!

Автор: Stanislaw 17.11.2012, 0:40

Цитата(aklyosov @ 17.11.2012, 1:19) *
Цитата(Павел Шварев @ 16.11.2012, 15:22) *
Цитата
Я не думаю, уважаемый Павел, что Stanislaw это делает с целью стать "крупным ученым".

Я не брата имел ввиду, а тех клоунов которых он как заводной повторяет.
"Адам" на иврите означает "человек" (замечательный аргумент, не так ли? Почему не назвать Кин-дза-дза", что означает "человек" на языке племени мумбо-юмбо? Причем здесь иврит??).

Три четвертое людей имеет и читает Библию.
- Она добро человечества, а не только древний Гэбрэёв.
Люди знают, что значит Адам почему всеобщее также в учебниках генетики на обозначeниe общего предка всех живущих людей.

Цитата
"Эти имена задали создатели ISOGG и YCC". Тоже замечательный аргумент. Типа раз политрук сказал, значит, так оно и есть.
Я не заинтересованный в деланию ономастического беспорядка. Я не страдаю наглостью!


Автор: aklyosov 17.11.2012, 0:56

Цитата(Stanislaw @ 16.11.2012, 16:40) *
Цитата
"Эти имена задали создатели ISOGG и YCC". Тоже замечательный аргумент. Типа раз политрук сказал, значит, так оно и есть.
Я не заинтересованный в деланию ономастического беспорядка.


Ну и я про тоже. Раз политрук сказал, так оно и есть. Тогда и "беспорядка" не будет.

Автор: kosmonomad 17.11.2012, 4:59

Цитата(Stanislaw @ 17.11.2012, 1:40) *
Цитата(aklyosov @ 17.11.2012, 1:19) *
Цитата(Павел Шварев @ 16.11.2012, 15:22) *
Цитата
Я не думаю, уважаемый Павел, что Stanislaw это делает с целью стать "крупным ученым".

Я не брата имел ввиду, а тех клоунов которых он как заводной повторяет.
"Адам" на иврите означает "человек" (замечательный аргумент, не так ли? Почему не назвать Кин-дза-дза", что означает "человек" на языке племени мумбо-юмбо? Причем здесь иврит??).

Три четвертое людей имеет и читает Библию.
- Она добро человечества, а не только древний Гэбрэёв.
Люди знают, что значит Адам почему всеобщее также в учебниках генетики на обозначeниe общего предка всех живущих людей.

Цитата
"Эти имена задали создатели ISOGG и YCC". Тоже замечательный аргумент. Типа раз политрук сказал, значит, так оно и есть.
Я не заинтересованный в деланию ономастического беспорядка. Я не страдаю наглостью!

Ну мы первопредка всех человеков звали бы Батя/Праотец/Прадед

Автор: Stanislaw 17.11.2012, 9:56

Цитата(kosmonomad @ 17.11.2012, 4:59) *
Ну мы первопредка всех человеков звали бы Батя/Праотец/Прадед

Батя - То есть кто? который? Более близкое определение?
Праотец - То есть кто? который? Более близкое определение?
Прадед - То есть кто? который? Более близкое определение?

Кто Адам - кто угодно знает, без более близких определений rolleyes.gif



Автор: kosmonomad 17.11.2012, 10:33

Цитата(Stanislaw @ 17.11.2012, 10:56) *
Батя - То есть кто? который? Более близкое определение?
Праотец - То есть кто? который? Более близкое определение?
Прадед - То есть кто? который? Более близкое определение?

Кто Адам - кто угодно знает, без более близких определений rolleyes.gif

Батя/Батька (Batia/Batka - транслитом) - так у нас зовут отца или старшего из рода. Это больше почётно и уважительно.
Праотец человечества - так?
Что-то про Адама услышал только недавно и всвязи с исследованиями ДНК. smile.gif

Да, и я попросил Вас объяснить как проводили рассчёты.

Автор: Igor1961 17.11.2012, 10:53

Цитата(kosmonomad @ 17.11.2012, 10:59) *
Ну мы первопредка всех человеков звали бы Батя/Праотец/Прадед

http://starling.rinet.ru/cgi-bin/response.cgi?root=config&morpho=0&basename=%5Cdata%5Csemham%5Csemet&first=1&off=&text_proto=&method_proto=substring&ic_proto=on&text_meaning=&method_meaning=beginning&ic_meaning=on&text_akk=&method_akk=substring&ic_akk=on&text_ebl=&method_ebl=substring&ic_ebl=on&text_amo=&method_amo=substring&ic_amo=on&text_uga=&method_uga=substring&ic_uga=on&text_can=&method_can=substring&ic_can=on&text_phn=&method_phn=substring&ic_phn=on&text_hbr=adam&method_hbr=substring&ic_hbr=on&text_arm=&method_arm=substring&ic_arm=on&text_bib=&method_bib=substring&ic_bib=on&text_jud=&method_jud=substring&ic_jud=on&text_syr=&method_syr=substring&ic_syr=on&text_new=&method_new=substring&ic_new=on&text_mnd=&method_mnd=substring&ic_mnd=on&text_ara=&method_ara=substring&ic_ara=on&text_dial=&method_dial=substring&ic_dial=on&text_sar=&method_sar=substring&ic_sar=on&text_gzz=&method_gzz=substring&ic_gzz=on&text_tgr=&method_tgr=substring&ic_tgr=on&text_tgy=&method_tgy=substring&ic_tgy=on&text_amh=&method_amh=substring&ic_amh=on&text_arg=&method_arg=substring&ic_arg=on&text_gaf=&method_gaf=substring&ic_gaf=on&text_hrr=&method_hrr=substring&ic_hrr=on&text_east=&method_east=substring&ic_east=on&text_gur=&method_gur=substring&ic_gur=on&text_mhr=&method_mhr=substring&ic_mhr=on&text_jib=&method_jib=substring&ic_jib=on&text_hss=&method_hss=substring&ic_hss=on&text_soq=&method_soq=substring&ic_soq=on&text_notes=&method_notes=substring&ic_notes=on&text_any=&method_any=substring&sort=number&ic_any=on.

Цитата
Proto-Semitic: *ʔadam-
Meaning: 'man; humankind'
Akkadian: adamu 'eine Person' (AHw. 10), 'an important, noble person' син. список (CAD АI 95); ʔadnātu NB
Ugaritic: adm
Phoenician: ʔdm 'man'
Hebrew: ʔādām
Judaic Aramaic: ʔādām (<Hbr?)
Syrian Aramaic: ʔādāmmāy 'human' (<Hbr)
Mandaic Aramaic: adam 'Adam' (<Hbr)
Arabic: ʔādām- 'Adam' (<Hbr); cf. ʔadīm- 'origin; provenance' (otherwise < 'blood')
Modern Arabic: Hdr ʔawādim 'men, humankind'; Dat_ ʔawādim 'man'
Epigraphic South Arabian: Sab ʔdm, ʔdwm-t, ʔdym 'vassals, servants, adepts'; Min ʔdm id.
Geʕez (Ethiopian): ʔaddam 'Adam' (loanword); cf. dom 'slave'
Tigre: ʔaddam 'people, men', ʔaddamatat 'crowds of people'; ʔaddemay 'little man'


а также
Цитата
Proto-Semitic: *ʔadam- ~ *dVʔVm-
Meaning: red
Akkadian: adam- 'red', daʔm- 'dark-colored, dark-red'
Ugaritic: ʔadm 'to paint red', ʔadmānu 'red (soil)'
Hebrew: ʔādam 'be red', ʔādōm 'dark-red', ʔădamdām 'bright-red, reddish'
Arabic: ʔudm-at- 'red color' [Blachère 63]; dmm 'to paint red' [BK 1 728]
Geʕez (Ethiopian): ʔaddāmāwi
Amharic: addäma 'be blood-red', dama 'dark-red'
Harari: dāma 'brown, dark-skinned'
Gurage: Cha dämyät 'red'


Судя по этимологии, черным он не был smile.gif

Любопытно, что по-японски младенец - "акачан" (赤ちゃん), букв. "красненький". Очевидно, по цвету новорожденного. Интересно, у древних семитов такая же аналогия была?

Автор: Люда 17.11.2012, 11:07

Cтанислав написал на новом Древе -"prepared for discussion". Могу сказать (в который раз), что большинство снипов, котрые мы предлагали еще в начале мая перенести от Перри в А1, теперь так и перенесены. Несколько снипов, по-моему мнению - ошибочно, оставлены в А00. Но обсуждать их - с кем? Я понимаю так, что Станислав только фиксирует, что скажут "там". Извините, мне кажется, Станислав, что сами Вы не умеете оценить, предковый это снип или производный. Поэтому, что дискутировать?
Видно, конечно, что Вам очень хочется свести все линии побыстрей к 1 предку. Хотя в презентации T.K. не решился это сделать - обе линии идут параллельно.

Автор: aklyosov 17.11.2012, 14:43

Интересны некоторые объяснения, данные Бонни Шрак на RootsWeb.

На вопрос ирландца, зачем они продолжают использовать слово "Адам", а не, например, Y-Root, что "is dumb", то есть "глупо", Бонни ответила, что это не они начали (We didn't start that, Paul), но они бы не использовали это слово в научных статьях (But it's not something we would use in a formal, academic paper!).

Собственно, то, что это глупо по ряду причин, мы здесь многократно обсуждали.

Затем, вопрос был, зачем продолжать называть новые обнаруженные ветви буквой "А", типа А0, А00 и так далее, хотя они разделены многими снипами (А0 и А00 разделены полусотней снипов) и явно заслуживают получить свои, отдельные буквы и стать отдельными гаплогруппами.

Мы-то здесь знаем, зачем, хотя Бонни не признается. Называя "А", они дают понять, что это ветви именно африканского происхождения. Это уже укоренилось в мозгах многих людей. это - то, что на Западе называется "индоктринированием", фактически - промыванием мозгов.

Вот что ответила Бонни:

A00 and A0 *are* intended to be different, distinct branch names. Absolutely, they are very distant from eachother. And as no one has commented, the distances between A0a1, A0a2, and A0b are also
impressively large.

Беглый перевод:

Да, А0 и А00 очень удалены друг от друга и мы хотели показать, что это - разные ветви (мой комментарий - вопрос был не о ветвях, а о разных гаплогруппах; то, что разные ветви - это и так ясно - АК). Расстояние между А0a1, A0a2, A0b тоже впечатляюще велико.

И добавила:

The best place to see all this at the present moment is probably Thomas' presentation,
http://prezi.com/kz2c-q4b-_m1/a00-on-the-y-haplogroup-tree/, and his
draft tree, http://ytree.ftdna.com/, though he hasn't uploaded the A00 SNPs to ytree yet -- probably that won't happen until the paper is accepted for publication(and before you ask, no, I don't know for sure
where it will end up being published.)

... Томас еще не поместил А00 на свое дерево, и не поместит, пока (его и Хаммера) статья не будет принята к публикации, и я (Бонни) не знаю, в каком журнале она будет опубликована.

И далее (Бонни):

Я бесконечно много дебатировала прошедшей зимой как называть эти ветви, называть ли их буквами U, V, W, X, Y, Z. Однако меня беспокоило, что эти буквы могут понадобиться позже для новых гаплогрупп. Далее, Томас и Хаммер считают, что не исключено, что новые, еще более древние, чем А00 ветви будут обраружены (which I think is remote! - "я считаю (Бонни), что это маловероятно), то они решили прибавлять новые нули. I'm not really keen on this system of nomenclature, but I admit that technically, it's feasible, and it avoids the problem of running out of letters of the alphabet. Maybe, with time, the scientific community will reach some other consensus on how to name them, but for now, it's what we have.

Следующий вопрос был о том же - зачем помещать новые ветви одна за другой под зонтиком гаплогруппы А.

Бонни:

I agree that this is a reasonable opinion, but its logic is not overwhelming. . . it's one of the options, but not the one that convinced Thomas and Michael, who are, after all, far more knowledgeable than I am about Y chromosome phylogeny, human population genetics, and so on.

Ответ такой, что Томас и Хаммер лучше знают, что делать, они более знающие в филогении, популяционной генетике и так далее.


Автор: aklyosov 17.11.2012, 14:55

Наконец, Бонни посмотрела дерево Stanislaw'a, которое он ей направил, и сделала следующее замечание:

I only wanted to explain that the section you've called just "A," in red, we are calling "A0-T." This is certainly not ideal, but we are using it, especially since there is no one who belongsto A0-T* (the paragroup), only its downstream clades. A0-T means that it includes all the clades on the treefrom A0 to T.

Перевод: секцию, которую вы назвали красными буквами "А", мы называем А0-Т. К ней никто (из тестированных) не относится, и это название означает, что А0-Т включает все гаплогруппы от А0 до Т.

Мой комментарий (АК) - потому-то я и сделал замечание Stanislaw'y, что он подтасовывает и манипулирует. Нет "А", как он нарисовал на своем "дереве". Нет никого, кто бы имел все снипы от А0 до ВТ, и пока такого не просматривается. Мы в статье, которая скоро выйдет (и выйдет раньше, чем у Томаса с Хаммером, которым мы в нашей статье вынесли благодарности) проанализировали полтораста снипов, и ни один из них не был общим в А0 и альфа- и бета-гаплогруппе.

Автор: aklyosov 17.11.2012, 15:11

Еще любопытная деталь. Stanislaw, видимо, вдохновленный нашими здешними дискуссиями, усомнился в расчетном возрасте ветви А00. Он написал (на форуме RootsWeb):

I doubt this great old age A00 !
Note that in the A00 is far fewer SNPs than in A-R.

То есть что А00 отделена намного меньшим числом снипов, чем их есть в А-R. Под А он, конечно, имел в виду альфа-гаплогруппу, потому что прямой лесенки снипов нет от африканцев к нам.

Бонни ответила: We are very well aware of this difference. То есть, мы хорошо об этом осведомлены.

И далее она дала объяснение, что гаплогруппа R наиболее хорошо изучена, как и другие западно-европейские гаплогруппы, и большинство известных снипов - именно оттуда. Наверняка в А00 найден только малый процент их снипов, и будут найдены еще много снипов.

Thus, in our WTY sequencing, in which all the segments of the Y are tested which already contain these SNPs, we are only starting to add a small percentage, maybe, of all the SNPs that actually exist in A00, while a relatively high percentage of all the R, etc., SNPs have already been found.

Мой комментарий (АК) - так как в самом деле тогда насчитали эти 338 тысяч лет, да еще с такой точностью?

И Бонни "объяснила":

In order that this bias doesn't affect the accuracy of the dating
estimate, extraordinary measures were taken by the postdoc who is a
specialist in this topic. After great technical feats ;-) it is
believed that he has been able to correct the dating estimate so that it
is not skewed by the disparities between the number of SNPs so far
discovered in A00, or A0, vs. A1-R.

Объяснение - в том, что у них есть замечательный postdoc (это - стажер, типа младшего научного сотрудника, только не на постоянной должности), и он сделал какие-то технические фокусы (при этом Бонни подмигнула), и теперь они верят, что все знают число всех этих недостающих снипов, и это было положено в основу расчетов.

Ну-ну. Картина появления этих "338 тысяч лет" стала приоткрываться.

Автор: Stanislaw 17.11.2012, 20:49

Цитата(Люда @ 17.11.2012, 11:07) *
... Несколько снипов, по-моему мнению - ошибочно, оставлены в А00. Но обсуждать их - с кем? Я понимаю так, что Станислав только фиксирует, что скажут "там". Извините, мне кажется, Станислав, что сами Вы не умеете оценить, предковый это снип или производный. Поэтому, что дискутировать?
Видно, конечно, что Вам очень хочется свести все линии побыстрей к 1 предку.
Людмила
Не хорошо, если в научном тексте писается не столько о научной материи, что о партнере дискуссии, об его задних мыслях фиксирований и может быть манипуляциях.
Так можно укокошить каждую науку!
Я так вот заявляю, что весь SNP (А00, А0, A, А1...) я получил только от T. Krahna.

Я переименовал только гаплoгруппу А0-Т (31 SNP) на А.
Я объяснил этот Bonnie Schrack на RootsWeb.
Это ведь отцовская группа для А1. Эти 31 SNP и во мне, и в уважаемыx АК и Игоре...
- Они верхний отрезок нашей генеалогии, хотя были открыть только через сравнить нашей генеалогии с А00.
И только столько моих... скрытых фиксирований, хитростей и манипуляции!

Автор: Stanislaw 17.11.2012, 20:58

Цитата(Igor1961 @ 17.11.2012, 11:53) *
Судя по этимологии, черным он не был smile.gif
А судя по этимологии, языке и Y-DNA - R1b был белый ли черный? laugh.gif

Автор: Stanislaw 17.11.2012, 21:43

Цитата(kosmonomad @ 17.11.2012, 10:33) *
Да, и я попросил Вас объяснить как проводили рассчёты.
Xотя я получил очень теплое признание около участия в этом веким открытию в генетике и антропологии я мало был информирован о ходу работа. Впрочем она еще продолжается....
Я до некоторых информаций доставал только "in secreto".

Основные тесты Perry оконченное уже 14 апреля.
Потом делали много других тестов STR и WTY в А0 и А1 (по собственной инициативе и за собственные деньги). Делали тоже тестирования на GENO-2.0.
Некоторыe SNP отпали, некоторое появились новое, напр. SNP о названии "AF".
Весь SNP были составлeны с мутациями шимпанзе и гориллы.
SNP гориллы облегчали познание, у кого возникла мутация: у шимпанзе ли у "Адама".
SNP шимпанзе служили также к датировке А00
Мои датировки были сделаны уже давно, так как я имел почти весь СНП группы "а". У меня от нескольких недель на дереве были 128.000 лет (я так не был воодушевлен критикой АК к снижению датировки от 338.000)

Michael H. обещал прислать мне свою лекцию на конфэрэнцйи ASHG, но только к частному известию и только по корректуре...

Автор: aklyosov 18.11.2012, 2:13

Цитата(Stanislaw @ 17.11.2012, 12:49) *
Не хорошо, если в научном тексте писается не столько о научной материи, что о партнере дискуссии, об его задних мыслях фиксирований и может быть манипуляциях.
Так можно укокошить каждую науку!


Уважаемый Stanislaw, не нужно приравнивать СЕБЯ к науке. Далее, не нужно подавать повода к тому, чтобы вас "укокошили", просто не нужно манипулировать. Тогда все будет в порядке.

Цитата(Stanislaw @ 17.11.2012, 12:49) *
Я так вот заявляю, что весь SNP (А00, А0, A, А1...) я получил только от T. Krahna.


Может, пусть он тогда с нами дискутирует?

Цитата(Stanislaw @ 17.11.2012, 12:49) *
Я переименовал только гаплoгруппу А0-Т (31 SNP) на А.


Почему же вы об этом не написали честно, прямым текстом? Что, мол переименовал по таким-то причинам. Этого же вы не сделали, не так ли? Вы просто подсунули, заменив одно на другое. Я это заметил, и сделал вам замечание. Это же заметила Бонни Шрак, и сделала вам то же замечание. Зачем это вам нужно? И почему вы переименовали на А, а не на W, скажем?

Цитата(Stanislaw @ 17.11.2012, 12:49) *
Это ведь отцовская группа для А1. Эти 31 SNP и во мне, и в уважаемыx АК и Игоре...


Ничего подобного. Как вам объяснила и Бонни, и я, нет таких людей, у которых есть цепочка от А0 до R. Зачем вы продолжаете манипулировать? Вы дествительно этого не понимаете, или делаете это умышленно?

Цитата(Stanislaw @ 17.11.2012, 12:49) *
И только столько моих... скрытых фиксирований, хитростей и манипуляции!


К сожалению, да.

Автор: aklyosov 18.11.2012, 2:15

Цитата(Stanislaw @ 17.11.2012, 12:58) *
Цитата(Igor1961 @ 17.11.2012, 11:53) *
Судя по этимологии, черным он не был smile.gif
А судя по этимологии, языке и Y-DNA - R1b был белый ли черный? laugh.gif


Он был европеоид. Догадайтесь сами, какого цвета была его кожа.

Автор: aklyosov 18.11.2012, 2:28

Цитата(Stanislaw @ 17.11.2012, 13:43) *
Xотя я получил очень теплое признание около участия в этом веким открытию в генетике и антропологии


О каком "открытии" речь? А0? А00? 338,000 лет? И о каком "теплом признании" речь? Вы открыли А0? Вы открыли А00? Вы рассчитали 338,000 лет?

Поделитесь, пожалуйста.

Мне, например, пока не ясно, что чем А00 отличается от А0. Кто из них Перри? Или Перри тоже открыли?

Цитата(Stanislaw @ 17.11.2012, 13:43) *
Некоторыe SNP отпали, некоторое появились новое, напр. SNP о названии "AF".


Что это за снипы AF? Вы об альфа-гаплогруппе? Только не нужно делать вид, что не понимаете, о чем речь.

Цитата(Stanislaw @ 17.11.2012, 13:43) *
Весь SNP были составлeны с мутациями шимпанзе и гориллы.
SNP гориллы облегчали познание, у кого возникла мутация: у шимпанзе ли у "Адама".
SNP шимпанзе служили также к датировке А00


Мы это тоже делали, только не заявляем о нашем "великом открытии". Скоро будет опубликовано.

Цитата(Stanislaw @ 17.11.2012, 13:43) *
У меня от нескольких недель на дереве были 128.000 лет (я так не был воодушевлен критикой АК к снижению датировки от 338.000)


Воодушевлены не были, однако 128,000 лет намного меньше, чем 338,000 лет, чем вы сейчас так воодушевлены. Вы хоть знаете, как эти 338,000 лет рассчитаны? Не могли бы показать, на КАКОМ числе мутаций? Если нет, то на чем строится ваше воодушевление? Вы же вроде как уже сами сомневаетесь?


Автор: казак 18.11.2012, 10:23

Слается мне, что прийдется в этом споре отталкиваться от первопредка всех человекообразных - кто там в блишайшем приближении - медведь? )))

Автор: Stanislaw 18.11.2012, 13:12

Сначала вступительное внимание.
Во время изучения научной Методологии диссертации объясняли нам, что в научном тексте не применяется личных местоимений такой как ты, вы. Спорится только с текстом и содержанием высказывания второго научного работника, а не анализируется его положение, мысли и духа.
Иначе диссертация не служит науке, а становится элементом борьбы междуличной.


Цитата
Цитата(Stanislaw @ 17.11.2012, 12:49)
Я переименовал только гаплoгруппу А0-Т (31 SNP) на А.

AK: Почему же вы об этом не написали честно, прямым текстом? Что, мол переименовал по таким-то причинам. Этого же вы не сделали, не так ли? Вы просто подсунули, заменив одно на другое. Я это заметил, и сделал вам замечание. Это же заметила Бонни Шрак, и сделала вам то же замечание. Зачем это вам нужно? И почему вы переименовали на А, а не на W, скажем?

Цитата(Stanislaw @ 17.11.2012, 12:49)
Это ведь отцовская группа для А1. Эти 31 SNP и во мне, и в уважаемыx АК и Игоре...

AK: Ничего подобного. Как вам объяснила и Бонни, и я, нет таких людей, у которых есть цепочка от А0 до R. Зачем вы продолжаете манипулировать? Вы дествительно этого не понимаете, или делаете это умышленно?

Ппочти все 31 SNP, которыe я обозначу как гаплoгрупа A, а Bpnnier/Krahn А0-Т были уже по крайней мере от июня тестированное [a]позитивно[/b] во WTY гаплoгруп и,G, I, J, L, T, R.
То есть они в нашем дереве, в нашей линии.
Я написал об этом к Bonnie на RootsWeb.
Я изменил только название, но SNP (31) остались те же самые в том же месте деревья!
Назвать этого манипуляцией - только обычная манипуляция.
Это вредное науке.

Цитата
Цитата(Igor1961 @ 17.11.2012, 11:53)
Судя по этимологии, черным он не был
Цитата(Stanislaw @ 17.11.2012, 12:58)
А судя по этимологии, языке и Y-DNA - R1b был белый ли черный?

AK:Он был европеоид. Догадайтесь сами, какого цвета была его кожа.

Но R1b в Камеруне черный и негроидный!!
Вы почему пишете, что негроидный “A” из Камеруна не могла имет белые потомки среди сегодняшниx BT, или что ваша Альфа не была никогда чернокожая или негроидная?

Цитата
Цитата(Stanislaw @ 17.11.2012, 13:43)
Некоторыe SNP отпали, некоторое появились новое, напр. SNP о названии "AF".
AK: Что это за снипы AF? Вы об альфа-гаплогруппе? Только не нужно делать вид, что не понимаете, о чем речь.

Снипы “AF” у Крагна, вместе с другими 31 SNP под названием А0-Т (у меня A). Подробности объяснит диссертация Хаммера

Цитата
AK: Мне, например, пока не ясно, что чем А00 отличается от А0. Кто из них Перри? Или Перри тоже открыли?
A00 это снипы Перри (52) и ему родственника (2).
“A0-T” это снипы наше (нашx пра-прэдков), найденное во вертикали дерева “A-T” по сравнению с снипами Перри (А00)

Цитата
Вы хоть знаете, как эти 338,000 лет рассчитаны?
Выполнили WTY шимпанзе и посчитали все снипы чeловек-шимпанс, полученныe в том же самом ВТЫ, в том же самом отрезке Y-DNA.

Автор: Люда 18.11.2012, 14:13

aklyosov

Цитата
Мне, например, пока не ясно, что чем А00 отличается от А0. Кто из них Перри?

Перри = А00, остальные вписались в общечеловеческую ветвь , объединенные снипами L1085-1155, которые мы сами предлагали перенести от Перри к А1(подгруппа А0 также отличается ими от Перри).
А L165 теперь не R1b?

Автор: aklyosov 18.11.2012, 16:04

Цитата(Stanislaw @ 18.11.2012, 5:12) *
Сначала вступительное внимание.
Во время изучения научной Методологии диссертации объясняли нам, что в научном тексте не применяется личных местоимений такой как ты, вы. Спорится только с текстом и содержанием высказывания второго научного работника, а не анализируется его положение, мысли и духа.
Иначе диссертация не служит науке, а становится элементом борьбы междуличной.


У нас, дорогой мой, здесь не диссертация, а дискуссионный клуб, Форум. Посмотрите в словаре слово "диссертация". И слово "дискуссия".

А теперь посмотрите в словаре слово "демагог". Это слово - очень к месту. Кто тут нас в расизме обвинял на основании того, что используем слово "архаичный"? Или это тоже "диссертация"?

Цитата(Stanislaw @ 18.11.2012, 5:12) *
Но R1b в Камеруне черный и негроидный!!


Вот это и есть демагогия. Вы прекрасно знаете, какая там причина. Если женитесь на негритянке, у вас дети тут же будут черные. Это что, аргумент про "Адама"?

Цитата(Stanislaw @ 18.11.2012, 5:12) *
Вы почему пишете, что негроидный “A” из Камеруна не могла имет белые потомки среди сегодняшниx BT, или что ваша Альфа не была никогда чернокожая или негроидная?


Вы все перепутали. Я никогда не писал, что альфа-гаплогруппа никогда не была чернокожая. Я всегда пишу, что вопрос открыт. А вот ваша гоп-компания пишет, что наши предки еще 70 тыс лет назад все были негроидные и в Африке. Все, что я пишу - это то, что никаких доказательств к этому нет, и надо рассматривать альтернативные объяснения. то и есть научный подход.

Более того, сейчас все больше и больше свидетельств, что наши предки не вышли из Африки. Читайте литературу. Никогда и никем не было доказано, что негроиды сами по себе превратились в европеоидов. Спросите любого антрополога, возможно ли это.

Цитата(Stanislaw @ 18.11.2012, 5:12) *
Некоторыe SNP отпали, некоторое появились новое, напр. SNP о названии "AF".
AK: Что это за снипы AF? Вы об альфа-гаплогруппе? Только не нужно делать вид, что не понимаете, о чем речь.
Снипы “AF” у Крагна, вместе с другими 31 SNP под названием А0-Т (у меня A). Подробности объяснит диссертация Хаммера


Меня не интересует, какие индексы придумывает Кран или Хаммер. Они и альфа-гаплогруппу называют "А" и говорят, что она была в Африке. То есть продолжаются те же манипуляции, потому что гаплогрупп не укоренены, география на них не указана.

Далее, AF - это от альфа-гаплогруппы до F. А вот A0-T у вас - это уже жульничество. Нет таких снипов, чтобы от шимпанзе прошли через А0 и далее до Т. Только не надо ля-ля, покажите, какие нуклеотиды у шимпанзе, какие в том же месте у А0, и какие в том же месте у Т, или хотя бы у ВТ. Вы же никогда не показываете, а только все те же ля-ля.

AK: Мне, например, пока не ясно, что чем А00 отличается от А0. Кто из них Перри? Или Перри тоже открыли?

Stanislaw: “A0-T” это снипы наше (нашx пра-прэдков), найденное во вертикали дерева “A-T” по сравнению с снипами Перри (А00)

Опять то самое ля-ля. См. мой комментарий выше. Покажите нуклеотиды.

Вы хоть знаете, как эти 338,000 лет рассчитаны?

Stanislaw: Выполнили WTY шимпанзе и посчитали все снипы чeловек-шимпанс, полученныe в том же самом ВТЫ, в том же самом отрезке Y-DNA.

Опять ля-ля. Покажите снипы-нуклеотиды.

Только таким может быть разговор. Мы в нашей статье их показали, и провели расчеты вплоть до шимпанзе. А вы?

Автор: aklyosov 19.11.2012, 14:16

Более полная информация от Tim Janzen:

Michael Hammer and Thomas Krahn have access to chimpanzee and gorilla DNA which allowed them to determine which SNPs were ancestral and which were derived in the haplogroup A00 sample. Thomas has done a WTY for both chimpanzee and gorilla. He has also run the 111-marker STR panel on the chimpanzee and gorilla DNA. However, there were no results for many STR markers with the standard primers.

The branch line from the A00/A0 node to the first node leading to haplogroups A0-T has 31 SNPs on it. There are 52 new SNPs on the branch line from the A0/A00 node to the first node within haplogroup A00. The man
in haplogroup A00 from S. Carolina thus has a total of 83 SNPs that are different from the other previously known branches of haplogroup A. A crucial piece of information from Thomas' presentation is that there are 1109 SNPs from the A00/A0 node to the human/chimp node and an additional 1109 SNPs from the human/chimp node to the chimpanzee that was tested. And there are 2084 SNPs (plus 27 additional tri-allelic SNPs) on the branch line from the haplogroup A00/A0 node to gorilla.

Michael Hammer also has access to 11 other samples that were collected years ago in Africa that turned out to be in haplogroup A00 once they had been properly SNP tested. They had previously only had very limited STR testing.

Это уже больше показывает работу, проведенную Хаммером и Краном.

Правда, 1109 снип-мутаций между общим предком шимпанзе и человека до общего предка А0/A00 при одной миллиардной мутаций в год означает расстояние чуть больше миллиона лет (1.1 миллиона лет). Поскольку общий предок шимпанзе и человека жил примерно 6 миллионов лет назад, то формальный расчет показывает, что общий предок А0/A00 жил 4.9 миллиона лет назад. Вряд ли это то, к чему пришли Кран и Хаммер.

Автор: Igor1961 19.11.2012, 14:35

Цитата(aklyosov @ 19.11.2012, 20:16) *
Michael Hammer also has access to 11 other samples that were collected years ago in Africa that turned out to be in haplogroup A00 once they had been properly SNP tested. They had previously only had very limited STR testing.

Это не те камерунцы-бамилеке из SMGF, о которых шла речь в нашей статье 1,5-летней давности? Их отличительная особенность - DYS438=16. В полном 43-маркерном варианте их 6 человек, с неполными вполне может быть 11. Тогда мы знали только 6 маркеров из медленной 22-маркерной панели, и лишь после того, как я отправил сообщение контактному лицу Перри на YSearch с предложением сделать апгрейд до 67, через несколько 3-4 месяца появились остальные маркеры. Перри вместе к камерунцами составляют компактную ветвь возрастом около 700 лет (пл памяти).

Автор: ОН Шоломицкий 19.11.2012, 14:43

Цитата(aklyosov @ 19.11.2012, 15:16) *
расчет показывает, что общий предок А0/A00 жил 4.9 миллиона лет назад. Вряд ли это то, к чему пришли Кран и Хаммер.

А чем обусловлена такая невероятная дистанция? И если брать во внимание возникновение последних гаплогрупп, то этот процесс прошёл, ну почти что, экстерном... wink.gif

Автор: aklyosov 19.11.2012, 19:29

Цитата(ОН Шоломицкий @ 19.11.2012, 6:43) *
Цитата(aklyosov @ 19.11.2012, 15:16) *
расчет показывает, что общий предок А0/A00 жил 4.9 миллиона лет назад. Вряд ли это то, к чему пришли Кран и Хаммер.

А чем обусловлена такая невероятная дистанция? И если брать во внимание возникновение последних гаплогрупп, то этот процесс прошёл, ну почти что, экстерном... wink.gif


Скорее всего, неверным подсчетом числа мутаций Хаммером и Краном. При такой константе скорости снип-мутаций, а сильно сомневаться в ней трудно, не в пять же раз различие - то должно быть не 1109 мутаций между общим предком шимпанзе и современным человеком, а примерно 5 тысяч мутаций. А если мутации считали правильно и все уже обнаружили, то наши африканские ребята повели свою линию практически от шимпанзе, или от родственного ему примата. Ну как могут наши политкорректные коллеги с этим согласиться?


Автор: Люда 19.11.2012, 21:24

Cтанислав, снова выступаю как Ваш корректор. Исправьте в своем рис. L1020, L1021 на L1120, L1121.

Автор: В.Юрковец 20.11.2012, 0:40

Цитата(aklyosov @ 19.11.2012, 20:29) *
Цитата(ОН Шоломицкий @ 19.11.2012, 6:43) *
Цитата(aklyosov @ 19.11.2012, 15:16) *
расчет показывает, что общий предок А0/A00 жил 4.9 миллиона лет назад. Вряд ли это то, к чему пришли Кран и Хаммер.

А чем обусловлена такая невероятная дистанция? И если брать во внимание возникновение последних гаплогрупп, то этот процесс прошёл, ну почти что, экстерном... wink.gif


Скорее всего, неверным подсчетом числа мутаций Хаммером и Краном. При такой константе скорости снип-мутаций, а сильно сомневаться в ней трудно, не в пять же раз различие - то должно быть не 1109 мутаций между общим предком шимпанзе и современным человеком, а примерно 5 тысяч мутаций. А если мутации считали правильно и все уже обнаружили, то наши африканские ребята повели свою линию практически от шимпанзе, или от родственного ему примата. Ну как могут наши политкорректные коллеги с этим согласиться?

Неужели они свой расизм ставят выше научной истины? Наиболее свободные и прогрессивные учёные уже давно поставили шимпанзе в род Гомо - http://www.medicina.lv/rus/second4.php?page=news&id=16&cat=1&thm=9

Автор: Боромир 20.11.2012, 1:02

Цитата(aklyosov @ 19.11.2012, 6:16) *
Правда, 1109 снип-мутаций между общим предком шимпанзе и человека до общего предка А0/A00 ...

Если посмотреть на http://prezi.com/kz2c-q4b-_m1/a00-on-the-y-haplogroup-tree/ Томаса Крана, то можно сделать вывод, что 1109 снип-мутаций разделяют шимпанзе (бонобо) и условного Y-хромосомного Адама (в данном месте эта терминология удобна). Однако не ясно на какой части Y-хромосомы обнаружены эти расхождения, но можно поспекулировать. Похоже, что речь идёт о 400 000 основаниях, покрываемых сейчас стандартно WTY проектом. Теоретически, при сходстве между шимпом и человеком 99%, количество обнаруженных снип-мутаций должно было быть 4 000. Как видно, порядок совпадает. Однако если не все человеческие праймеры сработали на ДНК шимпанзе, то Кран отсиквенировал меньше чем 400 000 нуклеотидов Y-хромосомы шимпанзе - отсюда и меньшее число 1109.

Кстати, на WTY проекте повторно (за последние пол-года) появилась информация о Перри #215865. Отсиквенировали ДНКу 14 апреля. Отсиквенировано 407 186 нуклеотидов. Новые снипы, найденные у Перри L1085-L1168,L1233,L1234,AF4-AF13. Откуда взялась серия AF не знаю, не копал.
Хроматограммы сиквенсов пока не доступны.

Автор: Stanislaw 20.11.2012, 10:19

Цитата(Боромир @ 20.11.2012, 2:02) *
Цитата(aklyosov @ 19.11.2012, 6:16) *
Правда, 1109 снип-мутаций между общим предком шимпанзе и человека до общего предка А0/A00 ...

Если посмотреть на http://prezi.com/kz2c-q4b-_m1/a00-on-the-y-haplogroup-tree/ Томаса Крана, то можно сделать вывод, что 1109 снип-мутаций разделяют шимпанзе (бонобо) и условного Y-хромосомного Адама (в данном месте эта терминология удобна). Однако не ясно на какой части Y-хромосомы обнаружены эти расхождения, но можно поспекулировать. Похоже, что речь идёт о 400 000 основаниях, покрываемых сейчас стандартно WTY проектом. Теоретически, при сходстве между шимпом и человеком 99%, количество обнаруженных снип-мутаций должно было быть 4 000. Как видно, порядок совпадает. Однако если не все человеческие праймеры сработали на ДНК шимпанзе, то Кран отсиквенировал меньше чем 400 000 нуклеотидов Y-хромосомы шимпанзе - отсюда и меньшее число 1109.

Кстати, на WTY проекте повторно (за последние пол-года) появилась информация о Перри #215865. Отсиквенировали ДНКу 14 апреля. Отсиквенировано 407 186 нуклеотидов. Новые снипы, найденные у Перри L1085-L1168,L1233,L1234,AF4-AF13. Откуда взялась серия AF не знаю, не копал.
Хроматограммы сиквенсов пока не доступны.

Уважаемый Боромир и Людмила,
Я вижу, что во вас моя надежда. smile.gif
Ваша роль - восстанавливать научное мышление - по правилам генетики
От генетики нельзя здесь отмежевываться!


Автор: Боромир 20.11.2012, 20:06

Цитата(Stanislaw @ 20.11.2012, 2:19) *
Уважаемый Боромир и Людмила,
Я вижу, что во вас моя надежда. smile.gif
Ваша роль - восстанавливать научное мышление - по правилам генетики
От генетики нельзя здесь отмежевываться!

Пан Станислав, Вы глубоко ошибаетесь. На этом форуме собралось несколько профессиональных академических учёных (бывших и настоящих). Наша задача, которую мы сформулировали сами себе - постараться максимально возможно восстановить историю своих предков. Методологическая база этих исследований во многом была заложена трудами Анатолия Алексеевича, которого Вы (да и не только Вы) или не хотите, или не можете понять.

Неизбежно, текущие исследования затронули тему происхождения человека. Вы не будете отрицать, что у Вас было два родителя - мать и отец, четыре прародителя (две бабушки и два дедушки) восемь пропрародителей и т.д. Т.е. каждый индивидуальный человек - это конечный продукт огромного количества предков в n-ом поколении. Поэтому концепция Адама, как единственного?!! предка, приемлема только со многими оговорками в применении к отдельным ситуациям (в моём предыдущем сообщеннии в этой теме была такая уместная ситуация) и никоим образом не может быть механически перенесена на теорию происхождение человека. Но именно это, сделал http://en.wikipedia.org/wiki/Spencer_Wells популяризируя генографический проект, который сам по себе является великолепной идеей.
Это привело к тому, что даже некоторые академические учёные стали слепо верить, что человечество произошло из Африки от некоего Адама и его древней подружки Евы. Во всяком случае, если взять наугад любую недавнюю академическую статью по этой теме, то там, как молитва будет повторена эта концепция.

Нужно отдать должное, что не все купились на концепцию Адама. Взять того же Майкла Хаммера - соавтора будущей статьи по коррекции Y-хромосомного дерева человека. Он не рассматривает эволюцию человека в упрощённом варианте - типа дерева или куста с ветвями отходящими от одного корня или ствола. Он видит её (во временном масштабе сотни тысяч - миллионы лет ) как ряд параллельных стволов время от времени сливающихся (http://www.cnshb.ru/AKDiL/0039/base/RI/003556.shtm ) и расходящихся, как он показал это на его http://www.youtube.com/watch?v=3O3GHIhEvOY, прочитанной в Университете штата Северной Каролины (США). Посмотрите, пан Станислав, Вам будет очень полезно, если ещё не видели.

Теперь немного о человеческих взаимоотношениях. Я, честно говоря, всё ещё надеюсь, что Вы наберётесь сил и извинитесь перед Анатолием Алексеевичем за расистские ярлыки, которые Вы на него вешали, думаю в пылу горячности, как на этом, так и англоязычных форумах.

Автор: Люда 21.11.2012, 10:04

Станислав, действительно зачем такие заявления? У Вас я то “укокошиваю” науку, то спасаю. Я не обращаю на это внимание. Вот Вы выкладываете бесстрастно очередное Дерево, конечно, у Вас опечатки, потому что для Вас это только чужие цифры. Вы же знаете, чем мы здесь занимались. Первоначально было объявлено 83 SNP Перри (по моим записям). 28 из них еще в начале мая, по- нашему мнению, оказывались не снипами Перри, а снипами нашей группы. Теперь, на презентации 12.11.12. так и оказалось почти со всеми снипами. 3-4 снипа не согласуются с нашими результатами. О них я спросила Thomas Krahn и получила ответ (надо еще проанализировать, но выкладываю сразу, думаю, будет интересно и другим):

Dear Ludmilla,

thanks for your interest in hg A00.

On 11/20/2012 04:22 AM, Людмила Рябченко wrote:
I hope that this address, which I took from the page Family Tree DNA Y Chromosome Browser, delivered a letter to Thomas Krahn.

Hello, dear Dr. Thomas Krahn,

On the Russian site http://www.rodstvo.ru/forum/index.php we closely follow your work on the study of a new line of humanity - A00. Announced in the spring of the new SNPs series L, we also tested for their ancestral status. Even then, we were able to understand the SNPs are a new branch, and which should be transferred to the main branch. Now, looking at your presentation, I had a few
questions to classify SNPs in a particular branch.

1. L1095 - I think it's SNP of A00, where the nucleotide found "a". In
the X chromosome of chimpanzees(according by NCBI), in the autosomes of macaques,
Pongo, Gorilla - "g" (in the Y chromosome of the chimpanzee homology was not found.)

We have also no L1095 result for the chimpanzee, however our gorilla
sample showed a clear A allele. Therefore we considered it as a A to G
mutation in the human branch.
We often see derived alleles on highly similar X chromosome sequences
and it is likely that they are getting transposed to the Y chromosome by
some recombination mechanism.
Of course we can never be sure that our sequencing primers actually
picked up really the gorilla Y chromosome, so the sequence may be
physically located on any other chromosome.


2. L1114 - I think this is not SNP of A00. Chimpanzees "g" as A00, then "a"-it derivat.

This could be true. Note that I highlighted it with a yellow background
which means it needs further investigation. We have no sequencing
results for chimp or gorilla.


3. L1121 - this SNP A00. Chimpanzees "a".

This conflicts with our chimpanzee sequencing results which have a G at
this position. We do not have Gorilla results for L1121 though.
Note that we actually did sequencing on chimp and gorilla samples on our
own. We didn't pick out published sequencing data from public sources.
Therefore there may be some variation.


4. L1129 - hard to say. Some nucleotides deleted compared to chimpanzees. What is the A00 in this area, I do not know.

The chimpanzee has some deletions, but the gorilla sequence aligns
linear to the human reference and has a T at the L1129 position.


5. Some SNPs declared before, now is not listed - L1112, L1153 (deletion), L1162, L1164, L1165, L1166. They have not been confirmed?

L1112 and L1153 are on the A1-V168 branch.

L1162,L1164, L1165 and L1166 are located on the P1 palindromic region. I
should have also removed L1163 (my mistake).
Because of the active recombination processes taking place in the
palindromic region I don't want to consider such markers for a
phylogenetic tree.
Also we do not have primate results for L1162 .. L1166.


6. I wanted to draw your attention (perhaps you know) that the L1099 and the V150 is the same nucleotide, in which there was a double mutation.

Yes, I'm aware that this is the same position. However L1099 is an A to
G mutation and V150 is a subsequent G to C mutation. So the base changes
G > C
The reason we know this is because GRC005628 is ancestral for V150.


7. I want to ask about the L165. What does this mean? Discussions in this regard have not yet met.

This is a pure coincidence. There are several of these in the primate
sequences. L165 was just a funny story that caught the attention of the
group administrator audience because it's a quite well known SNP among
the West Europeans.


Results of your work are very interesting. What discoveries lie ahead? I wish you good luck in the future.

I'd love to do Y research on male Neanderthal or Denisova samples but I
didn't get a hold on such a sample yet.


Regards,
Ludmila Ryabchenko


Thomas

Автор: Stanislaw 21.11.2012, 22:49

Уважаемый Пан Boromir et al.
Я благодарю за ваше высказывание.

1) Давайте начнем с последнего дела - обвинeния в расизме у АК.
Он часто требовал в этом деле. По-видимому его это обвинение очень проболело, что хорошо об нём свидетельствовало бы.

Я однако не ответил на это, думая, что сам себе это выдумал.
Ведь наверное он сам читал, как я (под другим именем) его наверное два раза защищал на DNA Forums, , на российском форуме по радио-разведке в ARIA (?), также на английском Мольгэне.
Откуда так у него это обвиняние мне?

Не хватает здесь цитат (вы не даете мне).
Но первый раз стало это когда я показал, что это настойчивое отрезание родов BT неафриканскиx от африканскиx может благоприятствовать расизму, вот какой наверное другое, чем обвинение в расизме.
Ведь и на теорию Дарвина о разных независимых рукавах, которыми вырастала эволюция человека и его расы, ссылались англичане, которые устраивали охоту на тасманийцев, или немецкие колонисты, которыe в южной Африкэ охотились на "самки пигмеев". Но я не обвиняю Дарвина о расизм, cколько наука о расах - только наука о расах; и не перерождается oнa во враждебные отношения к другим расам. Однако в этом подчеркиванию науки (ненаучным, по-моему) о независимом происхождении от неопределенных и неродных предков, вижу большyю опасность расизма.
Вот и все! Oпасность!

2) Другая тема это национализм, о который был АК обвиненный, а к которому, как я помню, признавался. Я понимаю, ”национализм” это слово очень многозначное в разных нациях: от здорового патриотизма - за агрессивным отношением к другим национальностям, неоднократно в утробе одной страны.
Я в такой вражде по отношению к другим национальностям никогда не обвинял АК.
В крайнем случае - я АК подозревал (не писал!) о неестественный патриотизм, который его склоняет, чтобы на Русской Равнине усмотреть укрытие всего рода R1a перед превратностями судьбы, или когда на Русской Равнине бы видеть колыбель всего неафриканскoгo человечества; я просто не вижу здесь научного обоснования.
Вот и все этой темы!

3) А относительно научности на этом форуме.
Так, я знаю, Боромир, что не нехватает здесь разумных и учёных людей. Поэтому я этот форум считал слишком наиболее из всеx похожиx устраивающее мои потребности. Долго нравилось мне прозрачное считание времени мутации STR (По этой причине, за быть представителем "народного генетика" Клёсова, дважды бановальи мне на польских форумах!).

Но что меня начало отталкивать?
a) Kогда я узнал oбщий грех все гэнэалoгов - это слишком большое доверие к СТР; никакие математические модели не учитывают большого числа многократных мутаций в том же месте, не даваться посчитать. На эту мою проблему АК реагировал смехом...

x) Во время дискуссии о происхождении человека выявилось глубокомысленное незнание основныx принципoв, как конструкция генеалогического древа SNP, незнание того, что это дерево не подчиняется никакому произволу, незнание того, что не надо дебатировать на тему его укорененя, потому что место корня всегда у стыка разветвления мутации двоx образцов. Оттолкнуло меня странное дерево STR гаплoгрупы Апфа. Оттолкнуло меня отрицание дерева как целое с общим забоем. Оттолкнуло меня приписываниe идеологии этим людям, которыe такое единство генетическyю видят отчетливо...

c) И что мне еще отталкивает?
То особенно, что все, который возражают против обязывающих здесь теорий, который даже в научном далеком мире думают и пишут иначе , здесь немилосердно смешиваные с грязью, что касается особенно генетиков популяцийных. О ценности популяцийнэй я имею и своя сдача.
Но это не причина унижания людей!!!
Часто применяли здесь это и к мне. Неоднократно три четвертое текста это: вы..., вы..., вы..., а небольшая часть текста о научной проблеме. Это очень отталкивает! Это антинаука!
Простите, я не хочу вac здесь беспокоить.
Я стараюсь мало писать, как можно меньше.
Может уже ничто...

Автор: aklyosov 22.11.2012, 1:07

Stanislaw'y, кратко.

1. Вы, судя по Вашим комментариям, не понимаете, что такое расизм.

2. Тогда тем более недопустимо, что вы используете это слово, не понимая его сути.

3. Если думаете, что понимаете, дайте свое, личное определение "расизма". Не надо списывать из энциклопедий.

4. Может тогда вам станет понятнее, что доказательство того, что бета-гаплогруппа (или ВТ) не выводится из африканских линий, не имеет никакого отношения к "расизму".

5. Вы меня не защищали, и в "защите" я не нуждаюсь. В том числе и от вас.

6. Когда вы говорите "я не вижу научного обоснования", мне становится смешно. В этом вы тоже не разбираетесь. Как и в вашем высказывании "нехватает здесь разумных и учёных людей". Кто бы говорил!

7. В STR вы тоже СОВСЕМ не разбираетесь. Как и в обратных мутациях. Как и в расчетах на основе мутаций в гаплотипах. Как, кстати, и в гаплогруппах. Я, честно говоря, не вижу, чтобы вы вообще хоть в чем-то разбирались, судя по вашим высказываниям. В любом случае, не в ДНК-генеалогии.

8. "Я стараюсь мало писать, как можно меньше".

Это не очень заметно.


Автор: Люда 22.11.2012, 9:10

Если вернуться к научным проблемам.
Мне стало непонятно. Получила еще 1 ответ от Thomas Krahn. На мой вопрос-почему использовали Бононо, он ответил:
We did not sequence Bonobo DNA. It was just a regular male chimpanzee
(Pan troglodytes) cell line NA03448.
We did use the same DNA for SNPs and STRs.

А в презентации указана ссылка на Ysearch 6RCUU, где (как обратил на это наше внимание Боромир записана та же линия NA03448, но P.paniscus.

Автор: aklyosov 22.11.2012, 15:30

Уважаемая Людмила,

Там у Т. Крана многое чего непонятно, хотя этому всему должно быть объяснение. Вот, например, следующая непонятность у Крана.

Это - последовательность в Y-хромосомном регионе DYS388 у человека с числом аллелей 12. Это число ясно читается между выделением черточками, как 12 повторов ATT.

GAATTCATGTGATTAGCCGTTTAGCGATATATACATATTATGAAAC--ATTATTATTATTATTATTATTATTATTATTATTATT--TGAGACGGACTCTCGCTCTGTCGCCCAG

Вот - тот же регион у шимпанзе. Число аллелей - 15.

GAATTCATGTGATTAGCCGTTTAGCGATATATACATATTATGAAAC--ATTATTATTATTATTATTATTATTATTATTATTATTATTATTATT--TGAGACGGACTCTCGCTCTGTCGCCCAG

У Крана для шимпанзе почему-то стоит число DYS388=12 - в YSearch 6RCUU, ясно написано "paniscus", и написано, что контакт - с Т. Краном.

Здесь такой простой случай, что перепутать 12 и 15 повторов просто невозможно. Говорить же (Кран) что работали с "троглодитом", когда у него же ясно написано "панискус" - это вообще странно.

Автор: Igor1961 22.11.2012, 15:45

Между гаплотипами шимпанзе Крана и шимпанзе Людмилы я насчитал 10 мутаций на 7-ми медленных маркерах, с учетом трактовки спорных маркеров Томасом. Для двух разных видов с общим предком более миллиона лет назад, по-моему, маловато. В-общем, надо выяснять, кто же записан в YSearch. Там есть ссылка на базу данных, откуда взят геном, но я не смог до нее добраться. Думаю, первичная информация о доноре должна там быть.

Автор: Люда 22.11.2012, 20:56

Igor1961:

Цитата
Там есть ссылка на базу данных, откуда взят геном

Thomas Krahn:
Цитата
we actually did sequencing on chimp and gorilla samples on our
own. We didn't pick out published sequencing data from public sources.

Я задала вопрос, может быть еще ответит.
Цитата
шимпанзе Людмилы
- скажете тоже...- NCBI.

Автор: Боромир 22.11.2012, 21:55

Цитата(Люда @ 22.11.2012, 12:56) *
Цитата
шимпанзе Людмилы
- скажете тоже...-
wub.gif

Автор: Люда 23.11.2012, 11:02

Все. Это была ошибка. Томас ответил, что исправит в Ysearch.
T.K.:

Цитата
I've corrected the Ysearch entry now. It was really Pan troglodytes and
NOT Pan paniscus. sorry.

Автор: В.Юрковец 23.11.2012, 12:27

Ничего себе, ошибочки! Вид перепутали. Это не ошибка, это что-то другое.

Автор: aklyosov 23.11.2012, 16:27

Ладно, с кем не бывает? Ну, ошибся. Не туда заглянул.

Сейчас ситуация оказывается сложнее. Как могло получиться, что, например, в DYS388 в опубликованной последовательности шимпанзе 15 повторов, а у Крана - только 12? Вид-то теперь один и тот же... А там повторы настолько простые, что разночтений, как считать, быть просто не может.

Автор: Люда 23.11.2012, 18:06

Наверно также, как у разных людей есть разные гаплогруппы, так и у шимпанзе. Это наверно случай с DYS388. Некоторые другие DYS - по-разному считали мы и они.

Автор: aklyosov 23.11.2012, 18:16

Это - одно из возможных объяснений. Другое - банальная ошибка в типировании.

В любом случае, это даст возможность Т. Крану попытаться разобраться в вопросе, и сравнить свой образец шимпанзе-троглодита с тем троглодитом, что находится в европейской базе данных. Если число мутаций в каждом локусе расходится столь значительно (а две мутации в DYS388 - это немало), то наука только выиграет. В этом будет и наш небольшой вклад, потому что привлекли внимание к тому, что Томас, судя по всему, не знал, и о чем, возможно, напишет.

Естественно, попгенетики это обсуждать не будут, они этого делать патологически не умеют. Школы потому что нет.

Автор: Igor1961 23.11.2012, 18:51

Цитата(aklyosov @ 24.11.2012, 0:16) *
Это - одно из возможных объяснений. Другое - банальная ошибка в типировании.

В любом случае, это даст возможность Т. Крану попытаться разобраться в вопросе, и сравнить свой образец шимпанзе-троглодита с тем троглодитом, что находится в европейской базе данных. Если число мутаций в каждом локусе расходится столь значительно (а две мутации в DYS388 - это немало), то наука только выиграет. В этом будет и наш небольшой вклад, потому что привлекли внимание к тому, что Томас, судя по всему, не знал, и о чем, возможно, напишет.

Там не только DYS388, который в медленной панели - один из самых быстрых маркеров, другие маркеры у двоих шимпанзе тоже расходятся. Повторяю их. Слева - Pan trogloditis Lyudmiia, справа P. trogloditis Thomas

DYS426 8 10 TTTTTTGTTGTTGTTGTTGTTGTTGTTGTT
DYS388 15 12
DYS438 5 5
DYS578 9 5.1
DYS641 10 10
DYS472 5 16 AATAATAATAATAATGATAATAATAATAGTAATAATAATAATAATAAT
DYS594 4 4.1
YS640 10 12
DYS492 9 10

Даже без спорных DYS426 и DYS472 набегает 10 мутаций на 7-ми маркерах. Столько раз ошибиться в типировании вряд ли возможно с тем опытом, как у Крана. Если шимпанзе - старый вид (я не знаю, так это или нет), то такое расхождение вполне реально, если эти самцы - из разных популяций. Это примерно тот же масштаб времен, что разделяет альфа- и бета-гаплогруппу. Возможно, несколько меньше из-за меньшей средней длины поколения у шимпанзе.

Автор: Люда 23.11.2012, 20:54

Цитата
такое расхождение вполне реально, если эти самцы - из разных популяций

У Томаса это культура клеток фибробластов. Сell line NA03448, я нашла в интернете, получены в Coriell Institute for Medical Research. (Кстати, попались работы по сравнению последовательностей разных приматов).
В NCBI для whole genome shotgun использовали ДНК "коренного жителя" Зап.Африки -"Clint" (a captive-born descendant of chimpanzees from the West Africa subspecies Pan troglodytes verus) - сборка 2.1. В сборку 3.1 (тоже в NCBI) включена У-хромосома другого самца "Gon".

Автор: Люда 23.11.2012, 21:38

Думаю, в основном, разница в способах подсчета. Например,
DYS426 8 10
GTTGTTTTTTTGTTGTTGTTGTTGTTGTTGTTGTT
Вот и получилось 10. По рекомендациям для подсчета повторов их считают вместе, если они прерываются количеством нуклеотидов не больше повторяющегося мотива. Здесь мотив-3, прерываются - 5(даже не 3х2), значит считать следует без первых 2х. На самом деле номенклатура эта в стадии становления и считают довольно произвольно для каждого DYSa (такое впечатление).

Автор: Люда 24.11.2012, 9:30

Относительно DYS594. Впервые описан Kayser et al. (2004), в дальнейшем его изучали
Butler et al. (2006) and Lim et al. (2007). В 2006 YSFG (international Society for Forensic
Genetics) рекомендовала для DYS594 мотив - TAAAA (Gusmão et al., 2006; Butler et al., 2006). Так [TAAAA]n он представлен в базе данных http://www.genebase.com/in/dnaMarkerDetail.php?t=y&d=str&m=DYS594
Однако больше повторов можно насчитать, если начать счет с AAATA, тогда получится
[AAATA] n+AAAAA, по существующим правилам 1-нуклеотидная замена допускается при подсчете количества повторов. Тогда DYS594 будет записан как N.1 повторов. Однако все же NIST ( U.S. National Institute of Standards and Technology, 2008) рекомендует использовать только AAATA мотив, без AAAAA.
Вывод: у Томаса DYS594 =4.1 (считали наверно AAATA(4)+ AAAAA)
Мы считали DYS594 =4 (TAAAA).
Думаю, DYS594 у нашим шимп. одинаков.

Автор: Igor1961 24.11.2012, 11:22

Это все пока предположения - мы не знаем, как выглядела последовательность, с которой работал Томас. Те, с которыми работали мы, опубликованы в последней статье в Advances in Anthropology. Так что он сам может все проверить, было бы желание.

Автор: Люда 24.11.2012, 15:24

Прошлась еще раз по тем DYSам, на которые указывал в сообщении №263 Игорь Львович. В некоторых случаях можно предположить, в чем причина разного счета (как правильно-?), в некоторых - необъяснимо.

DYS426=[GTT]8, Томас -10 возможно, считали [GTT]2 T5 [GTT]8
DYS388=[ATT]15 - наш счет (других вариантов нет), Томас – 12
DYS438= [TTTTC]3[TTTTG]1[TTTTC]1 =5=5
DYS578=[AAAT]9- наш счет (других вариантов нет), Томас –5.1
DYS641=[TAAA]10=10
DYS472=[AAT]5, Томас -16. Над этим случаем мы спорили на форуме. 16 получится, если считать, следуя номенклатуре - [AAT]5 [GAT]1 [AAT]3 [AGT]1 [AAT]6.
DYS594=[TAAA]4, Томас-4.1 возможно считали [AAATA]4 [AAAAA]1
DYS640=[TAAA]2 [CAAA]1 [TAAA]6 [CAAA]1 =10 , Томас-12 возможно считали [TAAA]2 [CCAA]1 [TAAA]6 [CAAA]1 [CCAA]1 [CCCA]1
DYS492= [TTA]9- наш счет (других вариантов нет, четкая делеция 2х триплетов, далее-полная гомология), Томас –10

Автор: aklyosov 24.11.2012, 15:48

В целом выглядит так, что у Томаса в приятелях другие шимпанзе.

Автор: Люда 25.11.2012, 8:06

Обнаружила небольшую ошибку у нас в статье. DYS578 у шимп. правильно выделен красным цветом повтор АААТ (9) , далее по ошибке записан еще 1 АААТ, его нет и мы его не считали-ошибка при написании.

Автор: Люда 25.11.2012, 16:55

From: "Lawrence Mayka" Rootsweb
http://www.prweb.com/releases/prweb2012/11/prweb10166775.htm
'Bigfoot' DNA Sequenced In Upcoming Genetics Study
Five-Year Genome Study At DNA Diagnostics Yields Evidence of Homo sapiens/Unknown Hominin Hybrid Species in North America

Автор: Люда 25.11.2012, 17:06

Сообщают, что несколько лет изучают ДНК Снежного человека - гибриды неизвестного гоминида(мужская линия) с чел.(жен.линия) из Сев.Америки.
???
Как поняла, из нескольких волосков, слюны выделены 20 мито-геномов и 3 полных ядерных генома-смесь человеческой ДНК и ДНК ни на что не похожей.
Пока никаких результатов миру не предъявлено.

Автор: Люда 27.11.2012, 20:52

Возвращаясь к своим проблемам:
По снипам, отмеченным желтым цветом (как требующим проверки) в презентации Thomas Kranh, можно сказать следующее:
L1092 - 3-аллельный снип (А00 – T, A1- G, шимпанзе, горилла, орангутанг –на Хромосоме– А). Если ставим его на линии А00,
то также надо ставить в А1 c другим значением нуклеотида.
L1113- cнип А00
L1114 - не снип А00 (шимпанзе и A00-G)
L1099 - 3-аллельный снип (А0 – G, шимпанзе-А, V150 в A0 - та же позиция – С)
V176 - в Ухромосоме шимпанзе и А1- С, в Хромосоме шимп.-Т. Если у A0 – Т, то это его снип
Остальные ”желтые” снипы, кажется, не противоречат данным NCBI
V157 – снип А0 –Т, шимп. –А
P305 –снип А1
L1070 – снип А0 (С), шимп.-G
L1073 – снип А0 (С), шимп.-Т
L1075 – снип А0 (Т), шимп.-С
L1076 – снип А0 (A), шимп.-G
L1078 – снип А0 (A), шимп.-C
L1079 – снип А0 (T), шимп.-C
L1080 – снип А0 (С), шимп.-T
L1081 – снип А0 (A), шимп.-Т
L1082 – снип А0 (G), шимп.-A

Автор: aklyosov 27.11.2012, 22:36

>Если у A0 – Т, то это его снип

Откуда у Вас появилось такое забавное сочетание A0-T?

То есть линия прямо от А0 до Т?


Автор: Люда 28.11.2012, 7:21

Правильно В.Юрковец понял - буква это нуклеотид.

Автор: aklyosov 28.11.2012, 17:29

Напомню, откуда этот курьез пошел.

>Откуда у Вас появилось такое забавное сочетание A0-T?
>То есть линия прямо от А0 до Т?


Поскольку Людмила на это не ответила, по поясню. Сочетание A0-T, A0-R и так далее употребляется для обозначения генеалогических линий от А0 до соответствующих гаплогрупп, что на самом деле никогда не наблюдалось. Только что Stanislaw на Форуме Родство завел про линию A0-R. Так что это сокращение уже занято другими понятиями.

Путаница произошла от того, что Людмила вместо А0 (T), как она обычно обозначает нуклеотиды, написала А0-Т. Это еще раз показывает, что к записям следует относиться внимательно.

А эту цепь выяснений в самом деле нужно удалить. Вскоре я это сделаю.

Автор: Люда 29.11.2012, 16:18

Продолжаю выяснять у Thomas Krahn то, что мне непонятно по снипам А00. Думаю, что количество их, правильное отнесения к ветвям будет в дальнейшем важно. На вопрос о L0192, который тоже кажется 3-аллельным(А00 – T, A1- G, шимпанзе, горилла, орангутанг –на Хромосоме– А). Мне казалось, если ставим его на линии А00,то также надо ставить в А1 c другим значением нуклеотида.
Thomas ответил:
"Yes, I marked L1092 as one of problematic markers becouse we didn't yield PCR products for chimp & gorilla with V172 primers at all. I'm not sure if I'd place another mutation event in the A0-T branch because it's muchmore likely that such a mutation would have happened in the human specific branch, long before A00 split off. The likelihood that such a mutation happened there is so much higher because the time span is significantly longer (to the chimp split) than the intersection between A00 and A0-T.
We are sure that there is no change of L1092 status in A1 because our A0a1a-P114 sample is G (ancestral in my definition)."

Понятно, если у A0a1a-P114 как и у А1 тоже -G, то это общий наш с ними снип (данные по A0a1a-P114 получены Томасом - проверка снипов Перри, для нас пока были неизвестны). Но когда прошла эта мутация, все-таки остается неизвестно. У общего нашего с А00 предка, или ancestral - как у шимп.-А, а в 2х линиях независимые мутации?

Автор: Боромир 29.11.2012, 21:50

Цитата(Люда @ 29.11.2012, 9:18) *
На вопрос о L0192, который тоже кажется 3-аллельным(А00 – T, A1- G, шимпанзе, горилла, орангутанг –на Хромосоме– А). Мне казалось, если ставим его на линии А00,то также надо ставить в А1 c другим значением нуклеотида.

Насколько помню в названиях первоначальных статей по рассматриваемой тематике выражение "биаллельный маркер" было must have, т.е. в ДНК генеалогии полиаллельные маркеры не рассматривались по определению из-за их бесполезности (в ДНК генеалогии). Видимо, в контексте прокси-шимпанзе снип L0192 надо выкинуть из рассмотрения. Вернуться к нему, снова будет можно с прокси-неандерталец, где L0192 будет биаллельной парой Т-G (если будет). Я так понял, что Томас завуалированно намекнул на это же, утверждая, что время до общего предка человека-шимпанзе очень велико. "The likelihood that such a mutation happened there is so much higher because the time span is significantly longer (to the chimp split) than the intersection between A00 and A0-T."

Автор: Люда 1.12.2012, 21:54

Боромир

Цитата
в ДНК генеалогии полиаллельные маркеры не рассматривались по определению из-за их бесполезности (в ДНК генеалогии).

Теперь рассматриваются. Про V161.1, V161.2 пишут "triallelic polymorphism". Вы рекомендовали эту статью R.Scorzzari,...F.Cruciani Molecular dissection of the basal clades in human Y chromosome phylogenetic tree.
PLOS ONE nov.2012 v.7 iss.11.

Автор: karandasov 12.3.2013, 21:50

На всякий случай, вот свежая статья в American Journal of Human Genetics

http://haplogroup-a.com/Ancient-Root-AJHG2013.pdf

Автор: Люда 6.6.2013, 11:01

http://en.molge.org/viewtopic.php?f=6&t=1132
Bonnie Schrack пишет:
Ищут финансовые средства для продолжения работы по выявлению новых А0 групп. На сегодня-
1 новый образец в 1000 Genomes относится к A0a1* , он негативный по отношению ко всем известным SNPs для A0a1a и A0a1b. Это только 2ой A0, найденный в 1K Genomes. Родина – Гамбия, намного западнее, чем известные до сих пор A0.
Планируется сбор новых образцов из районов, предполагаемой родины A00.
Matthew Fomine Forka Leypey уже имеет коллекцию Nkongho-Mbo A00 образцов вместе с более чем 2000 другими образцами из Cameroon. Не менее 30 членов A00 уже можно идентифицировать не только среди Mbo, но и из других этнических групп Cameroon. Несколько A0 также в этой коллекции.

Автор: Люда 6.6.2013, 21:00

Archaic lineages in the history of moden humans. D.Labuda, E. Zietkiewicz and V.Yotova. Genetics 156:799-808 (2000)
Ища статьи по сравнению митохонд., аутосомной и У-хромосомной ДНК, наткнулась на статью 2000 г., в которой поставлен вопрос – являются ли все современные популяции людей одной линией или было несколько независимо эволюционирующих линий? На примере dystrophin-гена (dys44) Х- хромосомы (участок размером 7622 нуклеотида) определен полиморфизм 36 сайтов. Ранее, в 1997 г. это было сделано на 250 образцах из разных популяций мира. В данной работе проверены более 1000 Х- хромосом, найдены 21 новых аллелей, 13 из которых уникальны для sub-Saharan Africa и только 2 ограничивались популяциями с других континентов (Япония и Папуа Новая Гвинея). В 19 популяциях мира (среди тестированных 868 хромосом) насчитали 64 гаплотипа данного гена. Гаплотипы, найденные в популяциях более чем 1 континента, называют общими. А присущие 1 континенту – специфическими. 14 гаплотипов классифицированы как общие. Хромосомы, несущие общий гаплотип гена дистрофина, составляли 82% всех образцов. Среди них 75% хромосом папуасов Новой Гвинеи, 93% азиатов, 93% европейцев, 96% америк.индейцев и только 58% африканцев. Все, кроме 1 гаплотипа, были найдены и у африканцев, у не-африканцев. Оставшиеся 50 гаплотипов из 64, были специфичными для разных континентов. 28 – найдены на хромосомах из Африки.
Анализ dys44 гаплотипов показал большой разрыв между африканскими специфическими гаплотипами и общими. В неафриканских группах общие и специфические гаплотипы близко родственны - специфические гаплотипы легко просматриваются как мутировавшие (в определенных, часто встречающихся позициях) общие гаплотипы; либо как рекомбинировавшие из 2-3 общих гаплотипов. В противоположность этому специфические африканские гаплотипы структурно несопоставимы с общими гаплотипами.
Т.е. если эволюция специфических гаплотипов неафриканских групп напрямую просматривается из общих гаплотипов, то африканские специф.гаплотипы представляют собой набор с разной эволюционной историей.
Проведены разные анализы этих данных – филогенетический, статистический, “PC plot”, построено максимально правдоподобное Древо. Выявлены ancestral нуклеотиды при сравнении с шимпанзе, гориллой и орангутангом (значащий ген это все-таки не У-хромосома, гомология здесь намного выше).
Вывод тот же, что в недавней статье Mendez … Hammer – смешивание с древними линиями. Т.е. повышенное разнообразие в ДНК sub-Saharan популяций объясняется не более старшим возрастом африканских популяций и не их “эффективным популяционным размером”. Авторы считают, что генетический пул в sub-Saharan Africa представлен 2 линиями, которые эволюционировали отдельно какой-то период, а потом гибридизовались.
И это 2000 год!


Автор: Igor1961 7.6.2013, 4:12

Цитата(Люда @ 7.6.2013, 3:00) *
Archaic lineages in the history of moden humans. D.Labuda, E. Zietkiewicz and V.Yotova. Genetics 156:799-808 (2000)
...И это 2000 год!

Уважаемая Людмила, спасибо за очень интересную ссылку. Содержание статьи совсем не соответствует говорящей фамилии первого автора - все серьезно и по делу. Обратите внимание, что работа по популяционной генетике (в строгом ее понимании) опубликована в журнале, посвященном в основном "чистой" генетике, и в редколлегии там нет никого из той компании попгенов, что заполнила собой все СМИ и специализированные журналы. Наверное, потому и прошла без обязательных реверансов в сторону "out-of-Africa" и AMOVA c BATWING'ами.

Все части пазла складываются в одну и ту же картину - дерево Y-хромосомных гаплогрупп, Х-хромостма из этой статьи и (найденные Вами) данные по гелиобактерии логичнее всего объясняются относительно поздним смешиванием местных архваичных и пришлых "молодых" популяций. Как из такой модели сделали вывод, что рост последней начался с выхода из Африки, вообще непонятно - это могло произойти где угодно, никаких прямых указаний на Африку нет.

Что касается поиска новых линий А0 и А00, то я бы не стал сбрасывать со счетов бедуинские племена Сахары - берберов и тубу. В их довольно замкнутых кланах какие-то из древних линий могли дожить до наших дней. Насколько помню, один из гаплотипов А0 в статье Кручиани (A1b в их нотации) был найден у бербера из Марокко. Можеть быть, это покажется нонсенсом, но не исключены сюрпризы и у австралийских аборигенов. Из личной переписки с австралийскими попгенетиками знаю, что там сейчас ведется работа по их подробному исследованию.

Автор: Павел Шварев 7.6.2013, 11:47

Цитата
Можеть быть, это покажется нонсенсом, но не исключены сюрпризы и у австралийских аборигенов.
Добавлю свои 5 копеек. Теоретически среди южноиндийских племен тоже наверное могут найтись.

Автор: Люда 9.6.2013, 23:39

На Facebook открыт A00-Cameroon Research Project.
B.Shrack дала Древо всех известных на настоящее время по FTDNA и SMSF А00 - на основании 38 STR. Образцы из 2 сообществ (Юго-Западный Камерун) - Fontem (Bangwa-этническая группа, говорящая на Ngwe) и Njungo (Mbo-этническая группа, говорящая на Lekongho или Nkongho), обе группы используют английский, как 2ой язык. Эти 2 группы отличаются 2 SNP - L1100 и L1149.
http://image-upload.de/image/Mp5iGE/a733adf3be.jpg

Автор: Igor1961 10.6.2013, 5:44

Такое дерево я тоже строил, как только стали доступны гаплотипы народности Мбо. К сожалению, они даны в нестандартном формате, без мультикопийных маркеров, так что время до предков обеих групп можно оценить лишь приблизительно. У меня получилось около 900 лет назад.

История заселения этих районов Западного Камеруна в точности неизвестна из-за отсутствия письменных источников. Считается, что основная часть современных его жителей - это потомки земледельческих племен, живших ранее на плато в центральной части современной Нигерии. Начиная с времн раннего Средневековья была постоянная миграция из этого прлодородного района на юг-юго-восток, отчести из-за перенаселения, отчасти под давлением скотоводов с севера. Датировка продходит, к тому же совпадает с датировкой для одной из ветвей А0, что отмечена чуть севернее (N71150 Boon + SMGF). Видимо, имеет смысл искать новые линии А0 и А00 также и в Нигерии.

Автор: Люда 10.6.2013, 11:36

Наверно все упирается в деньги. Пока планируется сбор и анализ образцов в Камеруне. Matthew Fomine Forka Leypey, как я поняла, сам проживает на этой территории и заинтересован.
Хорошо бы, если б дотестировали до 67 STRов имеющиеся образцы (вроде бы не так уж сложно, праймеры есть, присоседили бы к чему-нибудь и сделали, но видно, все считается, к тому же они в разных компаниях).
Получается, группа с Перри более "молодая", если у них L1100+ и L1149+ в отличии от других А00.

Автор: Люда 12.6.2013, 21:10

уважаемый Nimissin сообщил:

Цитата
12.06.2013, Москва 10:15:30 В День России, 12 июня, президент вручит в Кремле Государственные премии Российской Федерации за 2012г. Как сообщает пресс-служба главы государства, Государственной премии РФ в области науки и технологий удостоены:

- Анатолий Пантелеевич Деревянко - за выдающиеся открытия и труды в области изучения древнейшей истории человечества в Евразии и формирования человека современного анатомического типа;

- Глеб Всеволодович Добровольский (посмертно), Дмитрий Сергеевич Павлов и - Андрей Владимирович Адрианов - за цикл фундаментальных работ в области изучения биологического разнообразия, его сохранения и обеспечения экологической безопасности;

- Георгий Павлович Карзов, Ярослав Игоревич Штромбах и Алексей Владимирович Дуб - за создание нового класса высокорадиационностойких материалов для корпусов атомных реакторов и методов продления сроков их эксплуатации;

- Ефим Леонидович Межирицкий, Сергей Петрович Никулин и Виктор Александрович Шурыгин - за создание ракетного комплекса стратегического назначения "Ярс".

Интервью А.П.Деревянко
http://www.ras.ru/news/shownews.aspx?id=6e042940-ad9c-4a01-8a68-b5fc097cf614

Автор: Люда 11.7.2013, 10:11

Интересная картинка из статьи Continuity of Microblade Technology in the Indian
Subcontinent Since 45 ka: Implications for the Dispersal of Modern Humans
Sheila Mishra, Naveen Chauhan, Ashok K. Singhvi
http://www.plosone.org/article/fetchObject.action?uri=info%3Adoi%2F10.1371%2Fjournal.pone.0069280&representation=PDF
http://image-upload.de/image/E2vncw/f22b4b7702.jpg
Родина АСЧ - Индия smile.gif

Форум Invision Power Board (http://www.invisionboard.com)
© Invision Power Services (http://www.invisionpower.com)