Home
  Home    Tree    Branches    History    Library    Forum

Здравствуйте, гость ( Вход | Регистрация )

3 страниц V  < 1 2 3  
Ответить в данную темуНачать новую тему
> Z93 Parent, L342-
Рейтинг 5 V
Evg33
сообщение 21.8.2014, 21:33
Сообщение #41


Новичок
*

Группа:  R1a
Сообщений: 20
Регистрация: 8.10.2013
Из: Томск+Москва
Пользователь №: 4246



Цитата(Болло @ 22.8.2014, 2:22) *
Вы посмотрели, 72-ю строчку в вашем CSV файле, этот снип S4582 у вас есть.
Z95 у вас нет.

да, у меня показывает в csv
"Novel Variant","18985344","","","","C","A","High"


--------------------
Y: R-Z93*(KMS149+,Z94-,Z95-)
mt: H11a1
FTDNA: 312482, GM: F312482, ySearch: ZCY6G, MitoSearch: ZCY6G, Geno2, 23andme, SM.
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 21.8.2014, 21:39
Сообщение #42


Автохтон
**********

Группа:  R1a
Сообщений: 4096
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Цитата(Evg33 @ 21.8.2014, 21:33) *
Цитата(Болло @ 22.8.2014, 2:22) *
Вы посмотрели, 72-ю строчку в вашем CSV файле, этот снип S4582 у вас есть.
Z95 у вас нет.

да, у меня показывает в csv
"Novel Variant","18985344","","","","C","A","High"



Прекрасно! rolleyes.gif Ну вот теперь вы сами убедились что ваша ветка S4582! smile.gif

Поздравляю с обретением снипа своей ветки.

Теперь 32 снипа которые есть у вас - вам нужно сравнить с Загидом и другими S4582.

Зная географию распространения S4582 - вы сможете узнать более точнее происхождение вашего клана.

Всего наилучшего и успехов в поиске ответа о происхождении вашего клана.

С уважением. smile.gif


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Evg33
сообщение 21.8.2014, 21:55
Сообщение #43


Новичок
*

Группа:  R1a
Сообщений: 20
Регистрация: 8.10.2013
Из: Томск+Москва
Пользователь №: 4246



Спасибо!


--------------------
Y: R-Z93*(KMS149+,Z94-,Z95-)
mt: H11a1
FTDNA: 312482, GM: F312482, ySearch: ZCY6G, MitoSearch: ZCY6G, Geno2, 23andme, SM.
Перейти в начало страницы
 
+Цитировать сообщение
Evg33
сообщение 22.8.2014, 12:21
Сообщение #44


Новичок
*

Группа:  R1a
Сообщений: 20
Регистрация: 8.10.2013
Из: Томск+Москва
Пользователь №: 4246



на http://www.yfull.com/tree/R-Z93/ S4582 значится на уровне Z93, а Z95 на уровне Z94.


--------------------
Y: R-Z93*(KMS149+,Z94-,Z95-)
mt: H11a1
FTDNA: 312482, GM: F312482, ySearch: ZCY6G, MitoSearch: ZCY6G, Geno2, 23andme, SM.
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 22.8.2014, 13:10
Сообщение #45


Автохтон
**********

Группа:  R1a
Сообщений: 4096
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Цитата(Evg33 @ 22.8.2014, 12:21) *
на http://www.yfull.com/tree/R-Z93/ S4582 значится на уровне Z93, а Z95 на уровне Z94.



Уважаемый Евгений, они не на одном уровне, то что они написаны в одной строке - это означает, что они пока найдены у двух Z93*.

Обратите внимание к примеру на ветку YP449 (карачаевцы) http://www.yfull.com/tree/R-YP449/ - как видите там аж 17 снипов указано, но все они на разных уровнях.

Вы сами можете убедиться, что к примеру Z93 и S4582 - на разных уровнях, то есть они не синонимы.

1) Вот позиция Z93
CAAACAAAAATAAGAGTCACATTATGC
GGTATTATTCTTTTAACAAGCATC

2) А вот позиция S4582
S4582_F CTCAGCCTCCCAAAGTTCTGT
S4582_R TTAATCTTGATGTGTAGCTATGTGAGTC

Как видите совершенно различные участки Y-хромосомы.

У вас кстати есть 32 снипа, из них два известных, вот на них вам следует сосредоточится. smile.gif

С уважением.


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 9.1.2015, 23:54
Сообщение #46


Автохтон
**********

Группа:  R1a
Сообщений: 4096
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Народ у кого есть желание и возможность предлагаю скинуться на Фамили Финдер для грузинского клана Тамараули.

https://www.familytreedna.com/public/suyun/...ection=yresults
9. GEORGIANS R1a
293938 Tamarauli

Фамили Финдер стоит 99 долларов.

Этот тест необходим для определения аутосом подветви Z93*Parent.

Уже 35 долларов есть,
-20 долларов мои,
- 15 долларов с купона дал осетинский форумчанин Fire (Давид) с форума Аланла.


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Evg33
сообщение 24.12.2015, 2:25
Сообщение #47


Новичок
*

Группа:  R1a
Сообщений: 20
Регистрация: 8.10.2013
Из: Томск+Москва
Пользователь №: 4246



KMS149+ у меня


--------------------
Y: R-Z93*(KMS149+,Z94-,Z95-)
mt: H11a1
FTDNA: 312482, GM: F312482, ySearch: ZCY6G, MitoSearch: ZCY6G, Geno2, 23andme, SM.
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 29.12.2015, 7:37
Сообщение #48


Автохтон
**********

Группа:  R1a
Сообщений: 4096
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Цитата(Evg33 @ 24.12.2015, 2:25) *
KMS149+ у меня


Спасибо Евгений!


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Рекуай
сообщение 5.8.2017, 18:24
Сообщение #49


Участник
**

Группа: Y - ???
Сообщений: 104
Регистрация: 2.9.2012
Из: Рязань
Пользователь №: 3882



Обращает на себя два уровня, первый всплеск этногенеза Z93, от которого осталась куча минорных ветвей и повторный всплеск этногенеза Z94.
Перейти в начало страницы
 
+Цитировать сообщение

3 страниц V  < 1 2 3
Ответить в данную темуНачать новую тему
1 чел. читают эту тему (гостей: 1, скрытых пользователей: 0)
Пользователей: 0

 

              Mantlet IPB skin Designed by Fisana, IPBskins.ru
RSS Текстовая версия Сейчас: 21.9.2017, 11:49