Главная   |   Древние Рода   |   ДНК тесты   |   ДОК генеалогия             VK  |  OK  |  FB

Здравствуйте, гость ( Вход | Регистрация )

14 страниц V  « < 12 13 14  
Ответить в данную темуНачать новую тему
> A-wty, Walk Thru Y
сообщение 31.5.2012, 7:15
Сообщение #261


Группа: R1a, Академики
Сообщений: 6983
Регистрация: 24.2.2009
Пользователь №: 1721

Сообщения, не относящиеся к теме дискуссии, перенесены в раздел "Почти шутки". Совсем не хочется, чтобы эта интересная работа потонула в казуистике. Постоянные риторические вопросы о промежуточных звеньях и т.п. напоминают ситуацию, когда в разгар рабочего дня а авиационное КБ заходит некто и начинает приставать ко всем, чтобы ему предъявили 100 % доказательство, что самолеты вообще могут летать. Они же железные. Если все сотрудники бросят работу и станут всячески убеждать Фому Неверующего, самолет и вправду не полетит dry.gif

Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
+Цитировать сообщение
сообщение 31.5.2012, 10:26
Сообщение #262


Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612

DYS450 (TTTTA) у чел.8-11
Вытащила по статье "Forensic value of 14 novel STRs on the human Y chromosome" (2002) A.Redd et al.
Последовательность из 276 нуклеотидов. Авторы выделили в начале 8(GT), потом после большого промежутка 9(TTTTA) , еще после 12 букв 3(TTTTA) , после еще 1 T - 2(TTTTA) . Наверно для значения DYS берут первые 9 повторов(TTTTA), раз указывают значение аллелей у чел.8-11.
У шимпанзе
присутствуют первые 200 нуклеотидов, а прямо с начала повтора TTTTA последовательность обрывается - нет гомологии.

муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
+Цитировать сообщение
сообщение 31.5.2012, 21:03
Сообщение #263


Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612

Уважаемая Людмила, я бы не принимал рекомендации столь буквально и без раздумий. ...
Еще советую посмотреть по современному геному, КАК считали для современных случаев. Возможно, так и считали, до первого сбоя.

Уважаемый Анатолий Алексеевич и все дискутирующие, я сама боюсь увести вас куда-нибудь не туда (для меня это все ново, можно сказать, учусь on-line), но думаю, в случае DYS472 я права. Прилагаю еще раз его Alignment, посмотрите, как отмахнешься от этих дополнительных TAA? Мне кажется, прочитанное сегодня о современных случаях подтверждает мое мнение.
В статье "Forensic value of 14 novel STRs on the human Y chromosome" (2002) A.Redd et al. разобраны номенклатуры нескольких DYS. Вот например DYS447 - 2 вида повторов, считают их вместе (графа Allele).
ttatacattttagggagacataaggcat (TAATA) 6 (TAAAA) 1 (TAATA) 9(TAAAA) 1 (TAATA) 6 aaacattagttctgtccagaaaggcag
Allele (bp) YCC ID
23(216) YCC19 48bp (TAATA)6 (TAAAA)1 (TAATA)12 (TAAAA)2 (TAATA)3 48bp
26(221) YCC24 48bp (TAATA)6 (TAAAA)1 (TAATA)12 (TAAAA)2 (TAATA)6 48bp
24(216) YCC26 48bp (TAATA)7 (TAAAA)1 (TAATA)16 ------------------- 48bp
25(221) YCC33 48bp (TAATA)7 (TAAAA)1 (TAATA)8 (TAAAA)1 (TAATA)8 48bp
Проверила по данным своих мужчин, действительно, значения DYS447 у них - 23,24,25.

DYS463 (3 вида повторов - считают вместе)
27 (AAAGG)6 (AAGGG)19 (AAGGA)2
22 (AAAGG)6 (AAGGG)14 (AAGGA)2
23 (AAAGG)7 (AAGGG)15 (AAGGA)2
20 (AAAGG)6 (AAGGG)12 (AAGGA)2

муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
+Цитировать сообщение
сообщение 2.6.2012, 14:26
Сообщение #264


Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526

Уважаемая Людмила,

Большое спасибо за очень интересную и сложную работу, которые Вы провели. Вот так в итоге представляется "медленный" 22-маркерный гаплотип у шимпанзе:

DYS426 = 8
DYS388 = 15
DYS392 = 10
DYS455 = 4
DYS454 = ?
DYS438 = 5
DYS531 = ?
DYS578 = 9
DYF395S1a = ?
DYF395S1b = ?
DYS590 = ?
DYS641 = 10
DYS472 = 5
DYS425 = 10
DYS594 = ?
DYS436 = 10
DYS490 = ?
DYS450 = ?
DYS617 = ?
DYS568 = ?
DYS640 = ?
DYS492 = 9

По некоторым маркерам, как видно из данных по шимпанзе, за прошедшие несколько миллионов лет произошли резкие перестройки с обрывами или появлениями целых кусков Y-хромосомы, и для расчетов такие мутации, конечно, не подходят. Или их нужно принимать за 1 мутацию, то есть делать рискованное допущение. Это, например, в DYS594, где вместо 10 (человек) у шимпанзе 4. То же самое у DYS568, 4-->10 (у человека) [число аллелей у человека - с Ваших слов, я не проверял, у какого именно это человека, в какой гаплогруппе]. У DYS454, по Вашим данным, вообще 0-->11 (у человека). В DYS472 я пока оставил 5, потому что 16 посчитано с допущениями ("рекомендациями"), а эти рекомендации порой не работают. Надо просто положить рядом DYS472 у человека и у шимпанзе, и сравнить. Возможно, у человека эти "рекомендации" тоже не учитывались, и мы получим 8 и 5, соответственно.

В итоге мы имеем 11 аллелей у шимпанзе из стандартных 22, ровно половину. Уже хорошо для сравнений и оценок, часть из которых уже сделана.

Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
+Цитировать сообщение

14 страниц V  « < 12 13 14
Ответить в данную темуНачать новую тему
1 чел. читают эту тему (гостей: 1, скрытых пользователей: 0)
Пользователей: 0


              Mantlet IPB skin Designed by Fisana, IPBskins.ru
RSS Текстовая версия Сейчас: 25.1.2020, 6:33

Генеалогический сайт Рунета Сайт Всероссийского Генеалогического Древа Генеалогическая сеть Анализ фамилий Cайт рода R1a Краеведческий сайт Чеченский ДНК проект

© 2004-2015 RODSTVO.RU