Главная   |   Древние Рода   |   ДНК тесты   |   ДОК генеалогия             VK  |  OK  |  FB

Здравствуйте, гость ( Вход | Регистрация )



14 страниц V  < 1 2 3 4 5 > »   
Ответить в данную темуНачать новую тему
> A-wty, Walk Thru Y
Stanislaw
сообщение 17.3.2012, 19:57
Сообщение #41


Знаток
****

Группа:  R1a
Сообщений: 635
Регистрация: 24.10.2009
Пользователь №: 2444



Цитата(aklyosov @ 17.3.2012, 15:36) *
Посмотрел на драфт дерева Томаса. Похоже, там действительно проведены принципиальные перестановки, как мы и предлагали. Только одно Томас почему-то не принял, о чем я ему писал - это назвать первую, верхнюю позицию А0, тогда это и будет эквивалент альфа-гаплогруппы. А то у него начинается с А1, а потом идет А0, что нонсенс. Но, видимо, для Томаса назвать А0 - это фактически согласиться, что никакой Африки там нет.

А ее там и в самом деле лет. Кстиати, и ВТ уже выходит не от "африканских" субкладов, а практически от основания дерева. Опять, никакой наклейки "Африка" там нет.

Иначе говоря, тихой сапой Томас приходит к тому, о чем мы здесь говорили еще более полугода назад. Это просто не афишируется, а то получается измена.

У Томаша дерево начинается от Rоот=Y-Аdam

Потом идут два его "сыновя": А1 и А0, по отношению к себя "братья".
От А1 первая часть Афрыканцев,
а их более далекие ребята в самой большой части развернулись поза Африку.

От А0 произходит вторая часть африканцев, которaя почти целиком осталaсь в Африке.
Дерево ISOGG докладывает это само.

Результат самого нового тестирования WTY докладывает деревo Bonnie Schrack:


Приветы!!



--------------------
Y-DNA: R1a
mt-DNA: ? (Unknown)
Перейти в начало страницы
 
+Цитировать сообщение
Stanislaw
сообщение 17.3.2012, 20:17
Сообщение #42


Знаток
****

Группа:  R1a
Сообщений: 635
Регистрация: 24.10.2009
Пользователь №: 2444



Моя ошибка. Простите. mellow.gif
У Томаша еще старые обозначения.
Он нет обычай изменять названий гаплoгруп перед ИСОГГ


--------------------
Y-DNA: R1a
mt-DNA: ? (Unknown)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 17.3.2012, 21:23
Сообщение #43


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Цитата(Stanislaw @ 17.3.2012, 11:57) *
У Томаша дерево начинается от Rоот=Y-Аdam

Потом идут два его "сыновья": А1 и А0, по отношению к себе "братья".
От А1 первая часть Афрыканцев,
а их более далекие ребята в самой большой части развернулись поза Африку.

От А0 произходит вторая часть африканцев, которaя почти целиком осталaсь в Африке.
Дерево ISOGG докладывает это само.


Первая фраза - неверна.

У Томаса ничего с Root не начинается. Root=Adam у него просто стоит выше дерева, никакой конкретной связи с деревом нет. Это просто "идея".

Root = Adam

Далее начинается цепочка. Первое в ней звено:

Approx hg: A1b (ISOGG: A0)

Ни одного снипа с этого звена (которое обозначено как или A1b, или как A0) в R1a (как пример европеоидов) нет. Это то, что идет к Perry, Jones, Dorsey и т.д., и уходит на глубину более 160 тыс лет или даже более 200 тысяч лет. Эти мутации прошли мимо нынешних европейцев. То есть, возможно, когда-то давно эта ветвь ушла в Африку, но мы - не их потомки.

Надеюсь, это возражения не вызывает? Нет у нас их мутаций, и этим все сказано.

Вторым звеном идет то, что обозначено как:

Approx hg: A1b (ISOGG: A0a)

Их мутаций в нас тоже нет. Повторю опять - эта ветвь (или ветви) уходит на глубину более 160 тыс лет или даже более 200 тысяч лет. Эти мутации прошли мимо нынешних европейцев. То есть, возможно, когда-то давно эта ветвь ушла в Африку, но мы - не их потомки. Надеюсь, это возражения не вызывает? Нет у нас их мутаций, и этим все сказано.

Можете называть их африканцами, или детьми африканцев, но это НЕ НАШИ предки. Неужели все еще не понятно?

Следующей ветвью идут

Approx. hg: A0?
Approx. hg: A-L896 L92.2, L1035, L1036...,

Это все - африканские ветви, их мутаций в нас тоже нет.

Потом пошла альфа-гаплогруппа, которую Крусиани решил назвать A1a-T (и Томас как послушный ученик повторил), а ISOGG назвали А1.

Approx. hg: A1a-T (ISOGG: A1) V161, V168, V171, V174, V203, V238, V241, V250,

Красным выделено то, что есть у R1a1. То есть это и есть общий предок европеоидов. Это же снипы есть и у африканцев, которые не входят в первую ветвь, то есть у более недавних. Они НЕ ВЫХОДЯТ от африканцев, они идут ПАРАЛЛЕЛЬНО у нас и африканцев. На каком основании полагают, что наши предки произошли из Африки - мне остается непонятным.

Следующей пошла боковая африканская ветвь. У нас этих снипов нет:

Approx hg: A1a,Approx hg: A3 (ISOGG: A1a)

И вот далее пошла сводная гаплогруппа ВТ, наши предки, потомки альфа-гаплогруппы:

Approx hg: A2-T,Approx. hg: BT (ISOGG: A1b,A1b) V221

Вот и вся история. Никакой Африки в наших предках нет.


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 17.3.2012, 22:10
Сообщение #44


Легенда
************

Группа: R1a, Академики
Сообщений: 6921
Регистрация: 24.2.2009
Пользователь №: 1721



Цитата(Stanislaw @ 18.3.2012, 2:17) *
Моя ошибка. Простите. mellow.gif
У Томаша еще старые обозначения.
Он нет обычай изменять названий гаплoгруп перед ИСОГГ

Хороший обычай. Как говорит русская поговорка, торопливость нужна только при ловле блох.

Укорененное дерево, что приведено выше, это лишь небольшой фрагмент того, что можно извлечь из работы по WTY. Если взять 13 участников из разных гаплогрупп, для каждого из которых проверено около 400000 пар нуклеотоидов, то получится вот что:



Корень в том месте, куда его поместила Bonnie (?) - это попытка выдать желаемое за действительное. На деле все филогенические программы считают деревья без укоренения, как это показано на рисунке. Теоретически, корень можно поместить куда угодно, назначив набор нуклеотидов там предковым, а все, что отличается - мутациями от него. Из одного одного лишь набора снипов найти положение корня в принципе невозможно, это равносильно "подвигу" барона Мюнхгаузена, вытянувшего себя из болота. Для этого необходима независимая информация.

Собственно, этим и вызваны постоянно возникающие вопросы о снипах шимпанзе и неандертальца. Более того, снипы шимпанзе, скорее всего, мало чем в этом помогут, поскольку за 12 (т.е. 6 + 6) миллионов лет, разделяющих современных людей и современных приматов, у тех и других накопилось слишком много мутаций, чтобы провести тонкую работу по выявлению предковых аллелей в масштабе 100-200 тыс. лет. Это можно сравнить с попыткой сыграть в гольф, стреляя по полю с расстояния в несколько километров. Скажем, из дальнобойного орудия. При известном мастерстве можно попасть снарядом недалеко от лунки, но, чтобы пройти их все в нужном порядке - это уж вряд ли.

Потому приходится использовать косвенные методы. Один из самых распространенных опирается на принцип парсимонии (экономии пути), согласно которому положение корня более вероятно в той точке дерева, от которой расстояние до концов всех его ветвей примерно одинаково. Судя по рисунку из статьи Кручиани, им и руководствовались в той работе. Однако, если посмотреть на дерево, построенное на почти втрое большем наборе снипов (405 против 146), то картина окажется несколько иной, и корень норовит встроиться между участниками WTY гаплогруппы А и всеми остальными. То же самое мы видим и на дереве STR.

Почему в серии из 146 снипов, от V1 до V250, получилась асимметричная картина, пока не очень понятно. Я попробовал построить древо для участников WTY, исходя только из снипов Кручиани. Из тех 146-ти в FTDNA есть данные по 108-ми снипам этой серии для 12-ти участников из 13-ти. К сожалению, выпадает носитель гаплогруппы А3, которого не протестировали ни на один из них. Вот результат:



Собственно, деревом эту двузубую вилку, в которой все участники от гаплогруппы Е до R слились в одну точку, назвать сложно. Пока что возникает больше вопросов, чем ответов. В частности, куда исчезли снипы, разделяющие гаплогруппы в пределах ВТ? Опять же, генетические дистанции в этом дереве-рогатине не дают никакого указания, что корень уходит ближе к А0, а не располагается посередине.

Что бы ни дало последующее изучение, на сегодня аргументы о положении корня в текущей версии ISOGG выглядят очень шаткими.


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 18.3.2012, 0:52
Сообщение #45


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Цитата(Farkas @ 17.3.2012, 14:44) *
Эта тема заслуживает самого пристального внимания.


С этой мыслью, безусловно, спорить трудно. У нас все темы заслуживают самого пристального внимания.

Может, поделитесь, почему именно эта тема того заслуживает, и есть ли Вам что сказать по этому вопросу? Конкретно?


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
bugler
сообщение 18.3.2012, 1:40
Сообщение #46


Эксперт
*****

Группа: Знатоки
Сообщений: 1064
Регистрация: 10.5.2011
Из: Москвы
Пользователь №: 3366



Цитата(Igor1961 @ 17.3.2012, 23:10) *
Собственно, деревом эту двузубую вилку, в которой все участники от гаплогруппы Е до R слились в одну точку, назвать сложно. Пока что возникает больше вопросов, чем ответов. В частности, куда исчезли снипы, разделяющие гаплогруппы в пределах ВТ? Опять же, генетические дистанции в этом дереве-рогатине не дают никакого указания, что корень уходит ближе к А0, а не располагается посередине.


А были ли они, эти исчезнувшие снипы? Расчеты из т.4 №7-2011 (А.Клёсов) показывали, что общие предки различных гаплогрупп исходят из некой "бета-гаплогруппы", с которой можно ещё соотнести гаплогруппу F.
Может всё-таки, все эти редкие гаплогруппы являются субкладами более массовых?
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 18.3.2012, 3:16
Сообщение #47


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Вся эта текущая история с привязкой европеоидных (в частности) гаплогрупп якобы к африканскому происхождению наглядно показывает или откровенное мошенничество (хотя, казалось бы, какой смысл?), что можно мягче назвать откровенными и плохо скрываемыми натяжками, или полное непонимание научных принципов обоснования научных концепций.

Текущее состояние вопроса имеет слишком много степеней свободы, чтобы сделать определенное заключение, о чем совершенно справедливо пишет уважаемый Игорь Львович. Поэтому те, кто умышленно и вопреки всем этим степеням свободы привязывают гаплогруппы к Африке 140-160 тысяч лет назад, делают это совершенно безответственно.

Вот один из многих сценариев, который не противоречит данным по гаплотипам-гаплогруппам.

Примерно 160 тысяч лет назад на Земле обитали носители альфа-гаплогруппы. Привязка ее по гаплогруппам-снипам не делается, и сделать ее невозможно. Гаплогруппы-снипы не укоренены. От этой альфа-гаплогруппы пошли две основные ветви снип-мутаций (SNP) и соответственно гаплотипов (STR) - одна африканская, другая неафриканская. Это и есть та самая двузубая вилка. Ее можно изображать по-разному - или как вилку с параллельными линиями-зубцами, или как альфа-гаплогруппа посередине, и от нее радиально (в разные стороны) расходятся две основные ДНК-линии. Африканская линия ушла в Африку, неафриканская линия в Африку не ушла. Вторая от первой не происходит, что и подтверждают снипы как в драфте Томаса, так и в ISOGG.

В Африке африканские линии размножились, пресекались, переходили с место на место, и в итоге там сейчас их огромное разнообразие, накопившееся за 160 -200 тысяч лет, а то и 300 тысяч лет, учитывая, что есть еще одна линия, которая ушла в Африку еще до альфа-гаплогруппы. Большинство линий в Африке сместились, прошли бутылочные горлышки, и сейчас там много ошметков возоастом тысячу или несколько тысяч лет. Они образуют огромное поле "генетического разнообразия". Более того, примерно 40-50 тысяч лет назад к ним в Африку пришла гаплогруппа В, которая колоссально удалена от африканских гаплогрупп и гаплотипов, и которая изрядно добавила разнообразия. А пришла она от тех самых неафриканских линий, включая европеоидов. Гаплогруппа В к ним очень близка по гаплотипам, и очень удалена от африканских линий. Поэтому когда Бонни Шрак заявляет, что гаплогруппа В произошла от гаплогруппы А, она не понимает, что говорит. Она никогда не анализировала гаплогтипы, и не видела, какая там дистанция между А и В.

В итоге имеем два факта. Первый - что в Африке огромное "генетическое разнообразие", которое вовсе не означает, что другие гаплогруппы произошли от фариканских, это две независимые вещи. Второе - что неафриканские гаплогруппы-гаплотипы чудовищно удалены от африканских. Быть потомками первых они не могут.

Поэтому, когда генетики и прочие "попгенетики" утверждают, что разнообразие - значит предки, они просто неквалифицированы.

Теперь о судьбе второй принципиальной линии - неафриканцев. Они мирно эволюционировали все те 160 тысяч лет, параллельно но независимо от африканцев, создали наверняка свою культуру и цивилизацию, о которых мы ничего пока не знаем. Иногда проскакивают какие-то отдельные находки, но им никто не верит. И примерно 65-70 тысяч лет назад случился какой-то катаклизм, в результате которого почти все они вымерли. Возможно, это было извержение Тобы (60 тыс лет назад), возможно, что-то еще. Уцелело небольшое количество людей, которые начали все сначала. Время до этого "нового" общего предка - 64000 лет плюс-минус 6 тысяч лет. Там показывают мутации в гаплотипах, их разбег. Антропология дает находки этих людей и в Европе, и на Русской равнине, и на Ближнем Востоке, и для всех время примерно одинаковое - 42 тысяч лет назад, плюс-минус 4 тысячи лет. Поэтому пока можно предполагать, что этот огромный треугольник - и есть место или появления первых людей 160 тыс лет назад, или место их выживания 60-70 тыс лет назад.

Никакого превращение негроидов в европеоидов при этом не требуется. Собственно, эта гипотеза так и нашла своего подтверждения.

Естественно, "разнообразие" при этом уменьшается от Африки к Европе-Азии, но опять же это вовсе не означает, что африканцы - предки. Разнообразие языков при этом тоже уменьшается от Африки к Европе-Азии. И немудрено - там 160 тыс лет, здесь - 60-70 тыс лет. И это тоже вовсе не означает, что языки вышли из Африки.

Вот такая общая картина.



--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Stanislaw
сообщение 18.3.2012, 13:48
Сообщение #48


Знаток
****

Группа:  R1a
Сообщений: 635
Регистрация: 24.10.2009
Пользователь №: 2444



Цитата(”igor1961”)
Корень в том месте, куда его поместила Bonnie (?) - это попытка выдать желаемое за действительное. На деле все филогенические программы считают деревья без укоренения, как это показано на рисунке.
Ошибка!
Филoгэнэтическое программы служат только к строительству дерева гаплoтыпов в изолированных группах.
Не могут служить к строительству деревья SNP-ов!!!

Цитата
Теоретически, корень можно поместить куда угодно, назначив набор нуклеотидов там предковым, а все, что отличается - мутациями от него
Большая ошибка!
Дерево правильно построенное безошибочно показывает на корень, если только не заключает неустойчивыx снипов или back-снипов, или повторяющихся (быстро мутирующих) снипов.

Дерево снипов строится только через одкрывание иерархии снипов.
Принцип такая:
Сыновья это этот, которыe имеют все снипы отца, a кроме того свое собственное.
Отец это этот, которого снипы в сборе находятся у сынов и более далеких потомков. А у него нет снипов его потомков

Цитата
Потому приходится использовать косвенные методы. Один из самых распространенных опирается на принцип парсимонии (экономии пути), согласно которому положение корня более вероятно в той точке дерева, от которой расстояние до концов всех его ветвей примерно одинаково.
Oшибка!
Принцип парсимонии здесь нет ничево на работу.

По принципу герахии снипов строится два независимые деревья, исключающихсья взаимно снипов, начинающееся от А0 и А1 к нам, сегодняшних людей.
Первое, наиболее старое гаплoтыпы наследуют мутации (SNP) от Адама, но их не узнавается, потому что одинаковые по одной и по другой стороне.

Таким снипoм Адама напр. L74
http://www.tropie.tarnow.opoka.org.pl/images/l_74snip.bmp

Цитата(”alyosov”)
Approx. hg: A1a-T (ISOGG: A1) V161, V168, V171, V174, V203, V238, V241, V250,
Красным выделено то, что есть у R1a1. То есть это и есть общий предок европеоидов.

V161 также у всеx; я нахожу его напр. у A-P262, E-V13, R-M458.
Не хватает его только у R1b (U152 и L513). По-видимому наступила дэлецья.

Цитата
Это же снипы есть и у африканцев, которые не входят в первую ветвь, то есть у более недавних.
Bxодят, входят...
Эти „недавние” африканцы имеют эти снипы от своих праотцов с галoгрупы А1 (см. P262) и наследованы через всеx ее потомков.

Цитата
Они НЕ ВЫХОДЯТ от африканцев, они идут ПАРАЛЛЕЛЬНО у нас и африканцев. На каком основании полагают, что наши предки произошли из Африки - мне остается непонятным.
От кого эти мутации у BT(= А1b2)?

Цитата
Следующей пошла боковая африканская ветвь. У нас этих снипов нет:
Approx hg: A1a,Approx hg: A3 (ISOGG: A1a)
Вы думаете о М13 из Турции?
Это гаплoгрупа A1b...
Там какой-то дефект WTY. Я предлагал им повторный тест.

Цитата
И вот далее пошла сводная гаплогруппа ВТ, наши предки, потомки альфа-гаплогруппы:
Approx hg: A2-T,Approx. hg: BT (ISOGG: A1b,A1b) V221 Вот и вся история. Никакой Африки в наших предках нет.
V221 - у всеx африканцев гаплогруппы А1b, также у М13 и P262


--------------------
Y-DNA: R1a
mt-DNA: ? (Unknown)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 18.3.2012, 16:17
Сообщение #49


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Уважаемый Stanislaw,

Вы сделали 11 комментариев. Из них три неверных, в трех - непонимание принципов построения деревьев (не то чтобы неверно, а просто не понимаете), в двух Вы просто повторили то, что я уже сказал, и еще в трех - просто недоразумения.

Общий итог - отрицательно-нулевой.


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 18.3.2012, 17:40
Сообщение #50


Легенда
************

Группа: R1a, Академики
Сообщений: 6921
Регистрация: 24.2.2009
Пользователь №: 1721



Цитата(Stanislaw @ 18.3.2012, 19:48) *
Филoгэнэтическое программы служат только к строительству дерева гаплoтыпов в изолированных группах.
Не могут служить к строительству деревья SNP-ов!!!

Дерево правильно построенное безошибочно показывает на корень, если только не заключает неустойчивыx снипов или back-снипов, или повторяющихся (быстро мутирующих) снипов.

Дерево снипов строится только через одкрывание иерархии снипов.
Принцип такая:
Сыновья это этот, которыe имеют все снипы отца, a кроме того свое собственное.
Отец это этот, которого снипы в сборе находятся у сынов и более далеких потомков. А у него нет снипов его потомков

Вы это все серьезно пишете? Тогда покажите безошибочно, где находится корень реального дерева, построенного точно в соответствии с цепочкой экспериментально найденных снипов? Разумеется, с обоснованием, почему именно там, а не где-те еще.




--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
Stanislaw
сообщение 18.3.2012, 22:29
Сообщение #51


Знаток
****

Группа:  R1a
Сообщений: 635
Регистрация: 24.10.2009
Пользователь №: 2444




Цитата
Тогда покажите безошибочно, где находится корень реального дерева,

Oтвет выше, на дереве Bonnie Schrack.
Не связанное, "рассыпанное", открытэ в разных изученияx: Cruciani, Krahn, FTDNA, FTDNA и т. д. снипы,
дались уложить иерархически и укоpенить !!
Нельзя их повернуть и изменить.

Нижний - Jones (A0b1 - 13 SNP) и Dorsey (A0b2 - 24 SNP) - это "сыны" - вертикальная серия "сынов", может примерно тридцать тысяч лет.
У них серия общиx снипoв (19 SNP) - которые их "отeц" A0b (серия "отцов", может снова тридцать тысяч лет).

Оба, разом с их дядей (А0а - 11 SNP) - еще одна серия общиx снипoв (А0 -16 SNP). Представляет собой она как будто их “деда”.

Этого дерева нельзя повернуть, ни в другом месте укоpенить, как только в А0
Наконец все два деревья, A0 и A1, нельзя укоpенить иначе, как только в Root.




--------------------
Y-DNA: R1a
mt-DNA: ? (Unknown)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 18.3.2012, 23:39
Сообщение #52


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Цитата(Stanislaw @ 18.3.2012, 14:29) *
Наконец все два деревья, A0 и A1, нельзя укоpенить иначе, как только в Root.[/b]


biggrin.gif

Это прямо напоминает божественное начало. В нем тоже укоренено все человечество.

Дорогой Stanislaw, а куда Вы неандертальцев поместите? Тоже в root? А шимпанзе - тоже в root?

Как Вы вообще понимаете root?

Только недавно считали, что "хромосомный Адам" - начало начал человека. А сейчас нашли, что некотоорые пигмеи (может, и все?) имеют снипы, которых ни у кого больше нет. Они как бы пошли ниже root. Но Бонни и прочие с ней тут же опускают root и говорят, что все туда идет. Завтра найдут новую популяцию (например, недавнее китайское открытие), у которых мутации вообще другие - Вы с Бонни тут же делаете сальто-мортале и объявляете новый root. Это вроде как горизонт - подходишь ближе, а он отодвигается.

Я уже предсказывал год назад, что нет такой акробатики, на которую не пойдут попгенетики, чтобы якобы обосновать Африку. Root, судя по всему, всегда у Вас в Африке, где бы и когда бы он ни был. Просто по определению.

Надо уже в Библию поправку ввести. Первая Книга Моисеева, Бытие, Глава 1 должна начинаться так:

1. В начале сотворил Бог небо и землю. Земля называлась Африка.
И увидел Бог что это хорошо.


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 19.3.2012, 2:25
Сообщение #53


Легенда
************

Группа: R1a, Академики
Сообщений: 6921
Регистрация: 24.2.2009
Пользователь №: 1721



Цитата(Stanislaw @ 19.3.2012, 4:29) *
Цитата
Тогда покажите безошибочно, где находится корень реального дерева,

Цитата
Разумеется, с обоснованием, почему именно там, а не где-те еще.

Oтвет выше, на дереве Bonnie Schrack.
Не связанное, "рассыпанное", открытэ в разных изученияx: Cruciani, Krahn, FTDNA, FTDNA и т. д. снипы,
дались уложить иерархически и укоpенить !!
Нельзя их повернуть и изменить.

Нижний - Jones (A0b1 - 13 SNP) и Dorsey (A0b2 - 24 SNP) - это "сыны" - вертикальная серия "сынов", может примерно тридцать тысяч лет.
У них серия общиx снипoв (19 SNP) - которые их "отeц" A0b (серия "отцов", может снова тридцать тысяч лет).

Оба, разом с их дядей (А0а - 11 SNP) - еще одна серия общиx снипoв (А0 -16 SNP). Представляет собой она как будто их ”деда”.

Этого дерева нельзя повернуть, ни в другом месте укоpенить, как только в А0
Наконец все два деревья, A0 и A1, нельзя укоpенить иначе, как только в Root.


Пардон, а где обоснование, о котором я просил?

Рассуждения в духе "Авраам родил Исаака" таковыми считаться не могут. К примеру, что мешает поместить корень в конечную точку ветви А2-Р262, и все последующие цепочки снипов считать производными от исходного состояния, совпадающего с набором нуклеотидов у этого участника WTY? Все развилки прекрасно впишутся в такую схему, достаточно лишь сделать переотнесение предковых и производных значений. Если смотреть только схему снипов, и больше ничего, то опровергнуть такое укоренение невозможно, как и любое другое. Или Вы всерьез полагаете, что на хроматограммах подписано, какой нуклеотид со знаком плюс, а какой со знаком минус?

Напомню, в таком случае, каким образом было получено положение корня в работе Cruciani

Цитата
We used the 146 identified DNA variants and the MEGA 5 software to infer a maximum parsimony (MP) phylogeny of the human MSY... We obtained a strict-consensus MP tree, which was rooted with respect to either orthologous chimp MSY sequence (131 sites on the X-degenerated MSY) or paralogous human X chromosome sequence (15 sites on the X-trans- posed MSY), as reported in the UCSC Genome Browser (March 2006 chimp assembly and February 2009 human assembly, respectively).

То есть, авторы нарушили, с точки зрения уважаемого Stanislawa, как минимум, две неизвестно откуда взявшиеся "заповеди" - использовали филогенетическую программу для построения дерева снипов и руководствовались принципом парсимонии. Они же четко, со ссылками на оригинальные работы, указали, что укоренение делалось не по откровению в духе "нельзя укоренить иначе", а по внешним источникам. Как, собственно, и должно было быть.

Все это можно проверить и оценить, насколько правомочны были интерпретации Cruciani et al. А вопросы есть, и очень серьезные. К примеру, дерево участников WTY, что я приводил выше, рассчитано с помощью той же самой MEGA 5, но картину оно дает не совсем такую, как у Cruciani. Почему - это предмет научного обсуждения, а не заклинаний и обвинений в некомпетентности.


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
Боромир
сообщение 19.3.2012, 16:02
Сообщение #54


Эксперт
*****

Группа: R1a, Магистры
Сообщений: 1469
Регистрация: 2.4.2009
Из: Бостон
Пользователь №: 1923



Цитата(Боромир @ 16.3.2012, 22:09) *
На кое-что, видимо, смогу ответить, но нужно время, на подготовку, хотя бы день, другой.

Цитата(aklyosov @ 10.3.2012, 20:34) *
Цитата(Боромир @ 2.3.2012, 18:46) *
...этим дополнительным снипам (L1060-L1062), найденным у африканцев-архаиков было придано минусовое значение у хозяев и они пошли, как положительные, в корень бета-группы ВТ, т.е. стали нашими.


Не очень понятно. Эти снипы суть мутации в соответствующих нуклеотидах ДНК. Для того, чтобы назвать их снипами, нужно иметь их "родительскую" ДНК, и показать, что по сравнению с родительской в этих нуклеотидах произошли мутации. Иначе говоря, у шимпанзе в этих положениях должны быть одни нуклеотиды, у этих африканцев - другие. Тогда у шимпанзе там минус, у африканцев - плюс, то есть налицо мутации.

Вопрос первый - это так? Есть сравнение с шимпанзе?

Нет, не совсем так. Разница найдена между нами (клад ВТ) с одной стороны и всеми инкарнациями клада А (африканцами). Далее (если не знать какая мутация предковая) одному из аллелей в снипе приписывается минус и, соответственно, другой аллель в снипе становится плюсом. Кран решил, что минус надо приписать аллелям африканцев. Есть ли у него возможность сравнивать с последовательностью гоминид не знаю, но думаю, что есть.

На конкретном примере снипа L1060 решил проверить то, что предположил.

Первый шаг. Посмотрел какая информация имеется по этому снипу на зяблике2. Оказалось, что в базе данных L1060 отмечен только у одного из африканцев #N38376 (Jones), у которого он и был обнаружен. В настоящее время этот африканец является последним клиентом ФТДНА, у которого был сделан WTY тест и, по определению, этот снип не искали у всех предыдущих участников, даже если у них были отсиквенированы участки ДНК его содержащие и, поэтому данные по снипу (положительные или отрицательные) не заносились в базу данных.

Второй шаг. Поищем у кого же еще были отсиквенированы фрагменты, содержащие L1060.
По названию праймера (YSC0000254) для снипа L1060 с зяблика2 удалось вытащить 69 хроматограмм для 35 уникальных фрагментов (35 участников WTY). Посмотрел какой аллель у снипа L1060 на хроматограммах двух гаплотипов клада А (это все, что есть) и четырех гаплотипов (выбрал с разных ветвей) клада ВТ .

N38376..A-L896...C
229038..A-P262...C
M6314...E-M35.1..T
204221..J-L70......T
154501..N-M178...T
149865..R-Z280....T

У двух африканских гаплотипов снип L1060 представлен цитозином (С) и у всех проверенных ветвей клада ВТ - это тимин (Т).

Для полноты картины по кладу ВТ отсутствуют носители гаплотипов из ветвей В и С (к сожалению, они не проходили WTY тест).

Третий шаг. Ищу, каким же аллелем снип L1060 представлен у гоминид. Для этого произвольно вырезал последовательность из 160 нуклеотидов из хроматограммы африканца N38376 A-L896 (это две строки по 80 нуклеотидов).

TTAAAATGTATCTATATAACTTTGCTATACTAGTATAAAAATATTCATATTTCACAAATAAATTGCTCTTCATAACAGCCC
TTCCCAAACATGAACAGTCTTAAATTTTGGAAATGGACAAAATTTCAGCAGTGCTAATATACTACGATGGTATTGAAGC
Красным цветом в последовательности выделен L1060. Фрагмент хроматограммы можно посмотреть в конце сообщения. Этой последовательностью прошелся (программа BLAST) по соответствующим базам данных NCBI (информационный центр минздрава США). Удалось вытащить только гомологичные последовательности человека и шимпанзе.

AATTGCTTTTCATAA..человек.....первичная сборка...........NC_000024.9
AATTGCTTTTCATAA..человек.....альтернативная сборка...AC_000156.1
AATTGCTCTTCATAA..шимпанзе..сборка-2.1.4...................NC_006492.3
AATTGCTCTTCATAA..шимпанзе..альтернативная сборка...AC_000092.1

Подтвердилось предположение, почему только теперь вылез снип L1060 - обе используемых Краном для сравнения последоватьльности человека относятся к кладу ВТ и соответствующий аллель там (Т) - выделил синим цветом. Африканские гаплотипы различных А-кладов только недавно попали на WTY проект, что, наконец, позволило высветить эту мутацию.

Также становится понятным, почему Кран приписал предковое значение (С-) африканцам и производное (Т+) нам (кладу ВТ). У основной и альтернативной сборок шимпанзе там (С) и согласно бритве Аккама следует предположить, что у общего предка человека и шимпанзе был также (С), который сохранился у шимпанзе и африканцев, но мутировал у ВТ-клада.

Интересно побочное наблюдение. Использованный для поиска 160-нуклеотидный фрагмент кроме участков Y-хромосомы вытягивал также менее гомологичную последовательность из хромосомы #18 (гомология 85-90%). При этом вытянулись последоватьльности хромосомы #18 следующих приматов: человека, шимпанзе, орангутанга, макаки и гибона. Последовательности Y-хромосомы трех последних видов не были вытянуты, что подтверждает отмеченный в академической литературе факт более быстрого накопления мутаций в Y–хромосомах приматов, по сравнению с аутосомами. Это не значит что скорости (биаллельных)мутаций в Y-хромосоме быстрее, чем в аутосомах. Просто констатируется факт, что накопление мутаций более быстрое. Одной из возможных причин этого, возможно, является отсутствие рекомбинации между Х и Y-хромосомами.

Цитата(aklyosov @ 10.3.2012, 20:34) *
Вопрос второй - есть сравнение с неандертальцами? Потому что если у шимпанзе там минус (то есть этих мутаций нет), но у нендертальцев и африканцев там плюс, то эти снипы прошли у эректусов, и или у других гоминидов ПЕРЕД вилкой с неандертальцами. Итак - сравнивали ли с неандерами?

Мои попытки найти этот снип у неандертальцев не увенчались успехом, хотя предварительная сборка генома неандертальца уже была сделана. Или геном неандертальцев не внесен в базу данных NCBI или я не знаю как искать (что скорее всего).
Не знаю sad.gif также, как искать в геноме денисовского человека. У генома 30-кратное (очень хорошее) покрытие и он имеется в свободном доступе.
Цитата(aklyosov @ 10.3.2012, 20:34) *
Вопрос третий - есть ли сравнение с европеоидами?

См. ответ на первый вопрос.

Дополнение. Фрагмент хроматограммы с зяблика2 (для любопытных) smile.gif


--------------------
FTDNA Kit No. 143121, Russian Empire Project
Ysearch/mitosearch URQ2X


--------------------
Y-DNA: R1a-Z280 >CTS1211>CTS3402>Y33>CTS8816>Y2902>Y2910>L458* Восточно-Карпатская (Волго-Карпатская ветвь)
mt-DNA: H* (16085T, 16189C, 16519C, 263G, 315.1C, 522-, 523-)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 19.3.2012, 16:57
Сообщение #55


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Спасибо, уважаемый Боромир, за очень интересное и толковое описание.

Меня, естественно, привлекло вот это:

Цитата(Боромир @ 19.3.2012, 8:02) *
Разница найдена между нами (клад ВТ) с одной стороны и всеми инкарнациями клада А (африканцами)... У двух африканских гаплотипов снип L1060 представлен цитозином (С) и у всех проверенных ветвей клада ВТ - это тимин (Т).
... Также становится понятным, почему Кран приписал предковое значение (С-) африканцам и производное (Т+) нам (кладу ВТ). У основной и альтернативной сборок шимпанзе там (С) и согласно бритве Аккама следует предположить, что у общего предка человека и шимпанзе был также (С), который сохранился у шимпанзе и африканцев, но мутировал у ВТ-клада.


Итак, у африканцев (гаплогруппа А) и у шимпанзе там С, у нас - Т. То есть или мы НЕ произошли от африканцев и от шимпанзе с сохранением С, или африканцы и шимпанзе НЕ произошли от нас. Второе предположение отбрасываем как тривиальное.

Итак, мы НЕ произошли от (этих) африканцев с сохранением снипа. Есть, впрочем, альтернатива, что мы произошли, но в ходе эволюции С мутировал в Т, что мы и имеем. То же относится к шимпанзе.

Поскольку показано, что мы произошли от шимпанзе, то налицо мутация у нас С-->T. Но скептик скажет, что то же самое могло произойти и в ходе нашей эволюции от африканцев. То есть между шимпанзе и чернокожими гаплогруппы А нуклеотид С остался - за 4 миллиона лет, а от африканцев до нас мутировал - за 150 тысяч лет.

Теоретически может быть и такое. Но проблема для скептика в том, что таких случаев уже много. Не могут много нуклеотидов сохраниться 4 млн лет от шимпанзе до африканцев, а потом по команде "все вдруг" cразу все мутировать. Так не бывает.

Поэтому картина следующая:

На эволюционном пути от шимпанзе до людей была альфа-гаплогруппа. Наши мутации - от нее, и то, что между альфа-гаплогруппой и нами. Африканские мутации - от нее, от того, что было ДО альфа-гаплогруппы, и то, что накопилось позже, между альфа-гаплогруппой и африканцами.

От шимпанзе до альфа-гаплогруппы сохранялся тот нуклеотид С. Какие-то африканские линии ушли в Африку еще ДО альфа-гаплогруппы, они унесли тот С. В альфа-гаплогруппе уже был или С, или измененный Т. Если у африканцев ВООБЩЕ нет Т, и есть только С, то в альфа-гаплогруппе был С. Если у кого-то в гаплогруппе А есть Т, то в альфа-гаплогруппе был уже Т.

От альфа-гаплогруппы пошла вилка. В Африку ушли одни, к нам ушли другие, с мутацией Т, или из альфа-гаплогруппы, или полученной по дороге.

В любом случае, мы от африканцев гаплогруппы А не происходим.

Можно, конечно, придумать очередную акробатику, и, поверьте, так и будет. Например, скажут, что этот снип нестабильный, и он перекидывался туда-сюда, и уже не разобрать, но все равно Африка - родина. Следите за руками попгенетиков. Рукава у них низко опущены.


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Боромир
сообщение 19.3.2012, 19:25
Сообщение #56


Эксперт
*****

Группа: R1a, Магистры
Сообщений: 1469
Регистрация: 2.4.2009
Из: Бостон
Пользователь №: 1923



Цитата(aklyosov @ 19.3.2012, 9:57) *
В альфа-гаплогруппе уже был или С, или измененный Т. Если у африканцев ВООБЩЕ нет Т, и есть только С, то в альфа-гаплогруппе был С. Если у кого-то в гаплогруппе А есть Т, то в альфа-гаплогруппе был уже Т.

Верно первое предположение, поскольку один из двух африканцев, у которых обнаружен С, а именно: #229038 (клад A-P262) - входит в альфа группу. Таким образом, мутация C–>T произошла уже в бета группе (клад ВТ). Поэтому Кран и разместил снип L1060 на своем драфте в ВТ-ветке.
Цитата
В любом случае, мы от африканцев гаплогруппы А не происходим.

Естественно, нет.

Мне кажется, сейчас спор идет на уровне произошли мы от обезьяны или нет. Конечно нет, но у человека с обезьяной когда-то были общие предки (с шимпанзе около 6.5 млн лет тому назад).

Вопрос, где общие предки человека и африканцев (до альфа группы и альфа группы) жили? Палеонтология ответа не даёт, а генетики дружно показывают на Африку. Поэтому все дружно повторяют - человек вышел из Африки.

Более того тема сейчас усложняется тем, что мы произошли не от одного единственного предка, как принято считать в биологии. В нас (клад ВТ) около 2.5% генов неандертальцев. Без них (этих генов) мы бы, видимо, не освоили Евразию. А вот чтобы жить на островах - так потребовалось ещё 5% генов от денисовских людей.

Блок был прав частично - мы не только скифы, мы ещё и неандертальцы. laugh.gif


--------------------
FTDNA Kit No. 143121, Russian Empire Project
Ysearch/mitosearch URQ2X


--------------------
Y-DNA: R1a-Z280 >CTS1211>CTS3402>Y33>CTS8816>Y2902>Y2910>L458* Восточно-Карпатская (Волго-Карпатская ветвь)
mt-DNA: H* (16085T, 16189C, 16519C, 263G, 315.1C, 522-, 523-)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 19.3.2012, 19:51
Сообщение #57


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Цитата(Боромир @ 19.3.2012, 11:25) *
Мне кажется, сейчас спор идет на уровне произошли мы от обезьяны или нет. Конечно нет, но у человека с обезьяной когда-то были общие предки (с шимпанзе около 6.5 млн лет тому назад).


А почему "конечно нет"? Если у человека с обезьяной были общие предки, то кто был этим общим предком, как не обезьяна? Гиппопотам?

Цитата(Боромир @ 19.3.2012, 11:25) *
Вопрос, где общие предки человека и африканцев (до альфа группы и альфа группы) жили? Палеонтология ответа не даёт, а генетики дружно показывают на Африку. Поэтому все дружно повторяют - человек вышел из Африки.


Это еще раз показывает, что человек произошел от обезьяны. Во всяком случае, генетики.

Они показывают дружно на Африку по одной простой причине - что там "более высокое разнообразие". То есть мышление у них и осталось на том самом уровне, о кого произошли.

Я уже не раз приводил пример, что в Нью-Йорке более высокое разнообразие, чем в Пензе. Но это не значит, что Пенза произошла из Нью-Йорка. Генетики при своем унаследованном стадном чувстве не понимают, что бывает вилка с зубцами разной длины, но это не означает, что более короткий зубец непременно произошел из более длинного.

Цитата(Боромир @ 19.3.2012, 11:25) *
Блок был прав частично - мы не только скифы, мы ещё и неандертальцы. laugh.gif


Угу. Синантропы. "С жадными, раскосыми глазами".

А где гаплотипы неандертальцев? Или это только по женской линии?


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Stanislaw
сообщение 19.3.2012, 21:42
Сообщение #58


Знаток
****

Группа:  R1a
Сообщений: 635
Регистрация: 24.10.2009
Пользователь №: 2444



Цитата(k.lf @ 19.3.2012, 22:09) *
Мы произошли от инфузории туфельки. Но не об этом речь хочет вести А.Клесов. И мне интересно: почему арии и красивый, и умный народ! Кто его предок в древнем мире и его место обитания?

Мы уже знаем, что Арии это только род L342.2.

Жил и выстраивался отдельно, и не смешанный с другими, напр. Z280,
формировал язык и этнос арийский
и с ним мигрировал к юго-востоку.



--------------------
Y-DNA: R1a
mt-DNA: ? (Unknown)
Перейти в начало страницы
 
+Цитировать сообщение
Stanislaw
сообщение 19.3.2012, 22:23
Сообщение #59


Знаток
****

Группа:  R1a
Сообщений: 635
Регистрация: 24.10.2009
Пользователь №: 2444



Цитата(Боромир @ 19.3.2012, 19:25) *
Цитата
В альфа-гаплогруппе уже был или С, или измененный Т. Если у африканцев ВООБЩЕ нет Т, и есть только С, то в альфа-гаплогруппе был С. Если у кого-то в гаплогруппе А есть Т, то в альфа-гаплогруппе был уже Т.


Все мутации BT (и мутации его предков А1), в этом так и L1060, в африканском роде B.



--------------------
Y-DNA: R1a
mt-DNA: ? (Unknown)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 20.3.2012, 0:12
Сообщение #60


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Цитата(Stanislaw @ 19.3.2012, 14:23) *
Все мутации BT (и мутации его предков А1), в этом так и L1060, в африканском роде B.


Гаплогруппа В исходно не африканская, потому она и в сводной гаплогруппе ВТ. Она удалена от гаплогруппы А на 120 тысяч лет.

Поэтому в гаплогруппе В есть все снипы от альфа-гаплогруппы, что и в остальных неафриканских гаплогруппах.

Это сейчас гаплогруппа В живет в Африке, как и R1b-V88, которые ушли в Африку и теперь живут в Камеруне-Чаде.

Вы, уважаемый Stanilaw, когда не знаете, так хотя бы спрашивали. А Вы все норовите выскочить, и все время конфуз получается.

Учите материальную часть.


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение

14 страниц V  < 1 2 3 4 5 > » 
Ответить в данную темуНачать новую тему
1 чел. читают эту тему (гостей: 1, скрытых пользователей: 0)
Пользователей: 0

 

              Mantlet IPB skin Designed by Fisana, IPBskins.ru
RSS Текстовая версия Сейчас: 18.10.2019, 4:50
 
     




Генеалогический сайт Рунета Сайт Всероссийского Генеалогического Древа Генеалогическая сеть Анализ фамилий Cайт рода R1a Краеведческий сайт Чеченский ДНК проект


© 2004-2015 RODSTVO.RU