Главная   |   Древние Рода   |   ДНК тесты   |   ДОК генеалогия             VK  |  OK  |  FB

Здравствуйте, гость ( Вход | Регистрация )



6 страниц V  < 1 2 3 4 5 > »   
Ответить в данную темуНачать новую тему
> Sur250, Z2123, Z2124, L342.2, Z94 Башкирская-2 Подветвь, Bashkir-2 (Southern Ural-2), Iranians
Амиго
сообщение 27.8.2014, 19:25
Сообщение #41


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



excl.gif Итак теперь снип Y2633 можно заказывать и у Томаса Крана smile.gif .

http://shop.yseq.net/product_info.php?products_id=4459

Характеристика снипа Y2633:
HG19 Position: ChrY:17533051..17533051
Ancestral: C
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a2b (not listed)
Comments: Aka SUR22
Forward Primer: Y2633_F AAATCAGGTACCCTGAGATTTGG
Reverse Primer: Y2633_R CATACTGCAGCCAGGATGG

Снип Y2633 - древний, встречается у индоариев Лахора и Пенджаба, а также среди башкир из сако-динлинской подветви (по классификации И.Л.Рожанского эта подветвь называется Bashkir-2).

Y2633 почти эквивалентен снипу Y2632 который есть на FTDNA, но они находятся не на одном уровне.

Снип Y2633 нужно проверять у тех же гаплотипов, которые с большой долей вероятности могут принадлежать к субкладу Y2632. Это следующие гаплотипы:

3) 239995 Elan Bashkir Latip (XIX), Bashkortostan, Ural, Elan clan. (После результата по снипу Y2632, который уже заказан)
4) 270686 Miras Ufa Miras (XIX), Bashkortostan, Ural. (После результата по снипу Y2632, который уже заказан)
5) 247044 Harrison.
6) 182102 Fredrick Wilhelm Kuskie, eastern Prussia.
7) 307693 Tuktamyshev, Tatar.
8) N9119 Place John Place b Dec 9, 1719.

У части карачаевцев (240222, 306446), которые по STR сближаются с Y2632 - заказан Биг-Игрек, им снипы заказывать не нужно, т.к. все эти снипы будут у них сделаны.

1) 240222 Botash Karachay
2) 306446 Akbaev Aslan Hadji, Chokuna Efendi, Karachay. (Биг-Игрек)


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 4.11.2014, 7:15
Сообщение #42


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



О потомках Кипчак-хана статья
http://suyun.info/index.php?p=1_01112014_1


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Myrzalar
сообщение 4.11.2014, 8:00
Сообщение #43


Активист
***

Группа: i1
Сообщений: 352
Регистрация: 25.12.2013
Пользователь №: 4301



Цитата(Амиго @ 4.11.2014, 7:15) *
О потомках Кипчак-хана статья
http://suyun.info/index.php?p=1_01112014_1

Афарин.Сабитов все таки наш. А что родовое деление не помнит?


--------------------
Y-DNA: I1a.Z59.Z140+
mt-DNA: U5
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 4.11.2014, 9:19
Сообщение #44


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Цитата(Myrzalar @ 4.11.2014, 8:00) *
Афарин.Сабитов все таки наш. А что родовое деление не помнит?


Род к сожалению Мазит Сабитов свой не знает, но он помнит что его предки из башкир
http://www.familytreedna.com/public/Bashqo...ection=yresults

352662 Sabitov Bashkir


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Myrzalar
сообщение 4.11.2014, 14:23
Сообщение #45


Активист
***

Группа: i1
Сообщений: 352
Регистрация: 25.12.2013
Пользователь №: 4301



Не хилый такой род получается.
В рамках обследования башкир в 2012 году было собрано 62 образца
различных родовых образований: санкем-, бушман-, кара- и карагай-кыпчаки 4-
х административных районов южной части Башкирии. В результате анализа
разнообразия Y-хромосомы было зафиксировано 10 гаплогрупп, среди которых
доминирующей является Rla-M198(xM458) - более двух третей генофонда


--------------------
Y-DNA: I1a.Z59.Z140+
mt-DNA: U5
Перейти в начало страницы
 
+Цитировать сообщение
Alexandr-2
сообщение 4.11.2014, 16:00
Сообщение #46


Эксперт
*****

Группа:  R1a
Сообщений: 1241
Регистрация: 5.9.2012
Пользователь №: 3885



Цитата(Amigo @ 27.8.2014, 19:25) *
Снип Y2633 - древний, встречается у индоариев Лахора и Пенджаба, а также среди башкир из сако-динлинской подветви (по классификации И.Л.Рожанского эта подветвь называется Bashkir-2).


Уважаемый Амиго!

А вы не рассматриваете носителей данного снипа как потомков саков - динь-линей - монголов,
индоариев Лахора и Пенджаба с данным снипом - как потомков основателей Империи Великих моголов,
а башкир-2 - Золотой Орды?


--------------------
Y-DNA: R1a
Перейти в начало страницы
 
+Цитировать сообщение
Myrzalar
сообщение 4.11.2014, 16:11
Сообщение #47


Активист
***

Группа: i1
Сообщений: 352
Регистрация: 25.12.2013
Пользователь №: 4301



Цитата(Alexandr-2 @ 4.11.2014, 17:00) *
Цитата(Amigo @ 27.8.2014, 19:25) *
Снип Y2633 - древний, встречается у индоариев Лахора и Пенджаба, а также среди башкир из сако-динлинской подветви (по классификации И.Л.Рожанского эта подветвь называется Bashkir-2).


Уважаемый Амиго!

А вы не рассматриваете носителей данного снипа как потомков саков - динь-линей - монголов,
индоариев Лахора и Пенджаба с данным снипом - как потомков основателей Империи Великих моголов,
а башкир-2 - Золотой Орды?

Почему же тогда у так называемых Других Золотоордыцев ее нет,или практически нет?


--------------------
Y-DNA: I1a.Z59.Z140+
mt-DNA: U5
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 4.11.2014, 19:06
Сообщение #48


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Цитата(Alexandr-2 @ 4.11.2014, 17:00) *
Уважаемый Амиго!

А вы не рассматриваете носителей данного снипа как потомков саков - динь-линей - монголов,
индоариев Лахора и Пенджаба с данным снипом - как потомков основателей Империи Великих моголов,
а башкир-2 - Золотой Орды?


Нет как моголов не рассматриваем, монголы - если вы имеете ввиду потомков Бодончара мы относим к R1b-M269.

В китайских хрониках наш род так и называется Кун 渾, и относился к союзу телеских племён токуз-огузов.

Империя Великих моголов, хан Акбар и другие - это либо С либо R1b-M269.

В Золотой Орде потомки кунов-олобуре при Исмагиле сыне Башмана, относились с 1257 г. к сословию даругачей.


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 4.11.2014, 19:15
Сообщение #49


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Цитата(Myrzalar @ 4.11.2014, 16:11) *
Почему же тогда у так называемых Других Золотоордыцев ее нет,или практически нет?


Потому что куны не золотоордынцы, а потомки домонгольской аристократии степи (кипчакской), куны не были ни джучидами, ни чингисидами, но были инкорпорированы в состав Орды. Все эти джучиды, чингисиды, потомки Едигея и прочие не имеют никакого отношения к нашему клану.

Наоборот три поколения кунов воевали с монголами (Лач Сураман, Акоба и Башман), и только при Исмагиле сыне Башмана заняли промонгольскую позицию в Орде, и в дальнейшем поддерживали сторону Ногая, а впоследствии были на стороне Едигея и его потомка Мусы-бия.


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 6.11.2014, 7:34
Сообщение #50


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Цитата(Амиго @ 4.11.2014, 8:15) *
О потомках Кипчак-хана статья
http://suyun.info/index.php?p=1_01112014_1


Итак ещё несколько снипов сако-динлинской подветви Y2632 (И.Р. - Башкир-2, В.Т. - Южноуральская-2), теперь доступны для заказа у Томаса Крана:

SUR51
SUR52
SUR53
SUR54
SUR55
SUR56
SUR57
SUR58
SUR59
SUR60
SUR61
SUR63
SUR64
SUR65
SUR72
SUR73
SUR74
SUR76
SUR77.

На генеалогическом древе эти снипы выглядят так:


Возраста этих снипов:

1) От XXIII в. до н.э. — до XIII в. н.э. — снипы: SUR51-SUR56, SUR58-SUR61, SUR63-SUR69 (от предков саков-динлин и ниже);

2) От XIII в. н.э. — SUR77 (От Лач Сурамана и ниже);

3) От XIII в. н.э. — до XV в. н.э. — снип SUR78 (От Акобы и ниже);

4) От XV в. н.э. — снип SUR1 (От Басмана и ниже);

5) От XVI в. н.э. — снипы SUR76, SUR72 (От Баби Булата и ниже).

Легендарное генеалогическое древо кунов см. тут.

P.S. Для Александра-2. Оффтоп про происхождение борджигинов - перенесён в тему о Чингисхане. Александр-2 о Чингисхане общайтесь лучше в той теме, вот ссылка:

http://www.rodstvo.ru/forum/index.php?show...%E8%F1%F5%E0%ED

С уважением Амиго


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 7.11.2014, 21:59
Сообщение #51


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Древняя генеалогия (шежере) башкирских кипчаков, потомков кунов-олобуре. Подветвь R1a-Y2632, SUR53+.
Шежере хранится в архиве ИИЯЛ УНЦ РАН, сканирование оригинала ЭИ Проектом "Суюн" (с) от 07.11.2014 (защищено логотипом ЭИ Проекта "Суюн" - доступно для скачивания с 07.11.2014):



--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 23.1.2015, 4:05
Сообщение #52


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



1) У представителей Сако-Динлинской подветви (другие названия - Башкирская-2, Южноуральская-2) снип Y934 отрицательный -.

См. здесь. https://www.yseq.net/group_alleles.php?gid=70 Номер 1219.

Итого:

Массагето-аланская подветвь: Z2123 +, Y934 +, CTS1806 +, FGC10232-, y2632-
Усуньская подветвь: Z2123 +, Y934 +, CTS1806-, FGC10232 +, Y2632-
Сако-Динлинская подветвь: Z2123 +, Y934-, CTS1806-, FGC10232-, Y2632 +

Массагето-аланы (CTS1806) и усуни (FGC10232) ближе к друг другу, саки-динлины (Y2632) отделились от них раньше.

2) У 352662 Сабитов Башкир (FTDNA) подтвердился снип SUR1, он у него в плюсе +.
См. здесь. https://www.yseq.net/group_alleles.php?gid=70 Номер 1220.

Этот факт еще раз подтвердил, что 352662 Сабитов Башкир - является потомком кластера Басмана (Башкирские Кыпсаки).


Снипу SUR1 не более 650 лет.


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Atly
сообщение 30.3.2016, 20:45
Сообщение #53


Новичок
*

Группа:  R1a
Сообщений: 68
Регистрация: 11.5.2013
Пользователь №: 4123



242535 Aryeh Leib of Shpola (the Shpola Zeide) [Ukraine]
R1a-Z93+, Z94+, Z2124+, Z2125+, Z2123+, Y2632+, Y2633+ (Ashkenazi)


--------------------
Y-DNA: R1a.Z2123.CTS1806+
mt-DNA: U1b
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 30.3.2016, 21:13
Сообщение #54


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Спартак Дзанаев маздакит с перпендикулярного форума уже поспешил своих предков маздакитов к нам приписать. )


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 30.3.2016, 21:17
Сообщение #55


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Цитата(Atly @ 30.3.2016, 20:45) *
242535 Aryeh Leib of Shpola (the Shpola Zeide) [Ukraine]
R1a-Z93+, Z94+, Z2124+, Z2125+, Z2123+, Y2632+, Y2633+ (Ashkenazi)


Евреи это не нация, а профессия. У них все гаплогруппы мира. Те кто принимал иудаизм - становились евреями. Особенно среди них много представителей субклада Спартака Дзанаева))).

Какие то саки, тюрки или скифы приняли иудаизм и эти ашкеназы 242535 и др. - их потомки. В любом случае рад приветствовать брата и пусть если хочет - вступает в один из наш проектов (указаны внизу в моей подписи).


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 30.3.2016, 21:19
Сообщение #56


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Посмотрим что покажут данные палео-ДНК Ашина wink.gif


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 30.3.2016, 21:35
Сообщение #57


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Цитата
не ломался - отдал бы один из результатов Big Y на интерпретацию YFull, было бы ясно какие снипы разделяют Башкирскую2 ветку от ветки Ашкеназов-Z2123.

Без проблем - не ломайтесь, отдайте Лесла один из результатов BigY на интерпретацию к нам, чтобы было ясно какие снипы разделяют Башкирскую2 от ветки Ашкеназов-Z2123. И на будущее - всякий раз прежде всего требуйте с себя.


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Atly
сообщение 30.3.2016, 21:53
Сообщение #58


Новичок
*

Группа:  R1a
Сообщений: 68
Регистрация: 11.5.2013
Пользователь №: 4123



Цитата(Амиго @ 30.3.2016, 22:17) *
Какие то саки, тюрки или скифы приняли иудаизм и эти ашкеназы 242535 и др. - их потомки.


Какие ни есть, а все ж родня. biggrin.gif


--------------------
Y-DNA: R1a.Z2123.CTS1806+
mt-DNA: U1b
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 30.3.2016, 22:10
Сообщение #59


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



Цитата(Atly @ 30.3.2016, 21:53) *
Цитата(Амиго @ 30.3.2016, 22:17) *
Какие то саки, тюрки или скифы приняли иудаизм и эти ашкеназы 242535 и др. - их потомки.


Какие ни есть, а все ж родня. biggrin.gif


Уж лучше ашкеназы родня, чем всякие маздакиты вроде Спартака Дзанаева. rolleyes.gif


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение
Амиго
сообщение 30.3.2016, 22:20
Сообщение #60


Автохтон
**********

Группа: R1a, Магистры
Сообщений: 4408
Регистрация: 12.2.2010
Из: Bashkortostan
Пользователь №: 2713
Страница в ЖЖ:-



В этой статье есть информация про скифские и тюркские корни части ашкеназов.
http://suyun.info/index.php?p=2_30042015_3&LANGRUS

Скифы по данным палео-ДНК Z2123.


--------------------
Amigo

База данных У-ДНК Soraman http://suyun.info/index.php?LANG=ENG&p=b

Если что буду общаться на http://nations.unoforum.pro/

Наш сайт по этногеномике suyun.info

ЭИ Проект ''Suyun'' на сайте Томаса Кранна https://www.yseq.net/group_alleles.php?gid=70

Если вы новичок и не знаете какая у вас ветка, и что вам дальше заказывать, то см. тут.

Matches * Матчи http://www.familytreedna.com/public/Bashqo...ection=yresults
Nations * Народы http://www.familytreedna.com/public/suyun/...ection=yresults
Clans * Кланы и фамилии http://www.familytreedna.com/public/people...ection=yresults

The descendants of the ancient tribes * Потомки древних племён http://www.familytreedna.com/public/TuranS...ection=yresults

Среди цветов вишня, среди людей самураи...

--------------------
Y-DNA: R1a.Z2123. SUR250+, SUR22+
mt-DNA: H
Перейти в начало страницы
 
+Цитировать сообщение

6 страниц V  < 1 2 3 4 5 > » 
Быстрый ответОтветить в данную темуНачать новую тему
1 чел. читают эту тему (гостей: 1, скрытых пользователей: 0)
Пользователей: 0

 

              Mantlet IPB skin Designed by Fisana, IPBskins.ru
RSS Текстовая версия Сейчас: 16.11.2019, 5:46
 
     




Генеалогический сайт Рунета Сайт Всероссийского Генеалогического Древа Генеалогическая сеть Анализ фамилий Cайт рода R1a Краеведческий сайт Чеченский ДНК проект


© 2004-2015 RODSTVO.RU