Главная   |   Древние Рода   |   ДНК тесты   |   ДОК генеалогия             VK  |  OK  |  FB

Здравствуйте, гость ( Вход | Регистрация )



15 страниц V  « < 12 13 14 15 >  
Ответить в данную темуНачать новую тему
> Обновленное Генеалогическое Дерево Гаплoгрупы A И Современного Человека.
Люда
сообщение 23.11.2012, 18:06
Сообщение #261


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



Наверно также, как у разных людей есть разные гаплогруппы, так и у шимпанзе. Это наверно случай с DYS388. Некоторые другие DYS - по-разному считали мы и они.


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 23.11.2012, 18:16
Сообщение #262


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Это - одно из возможных объяснений. Другое - банальная ошибка в типировании.

В любом случае, это даст возможность Т. Крану попытаться разобраться в вопросе, и сравнить свой образец шимпанзе-троглодита с тем троглодитом, что находится в европейской базе данных. Если число мутаций в каждом локусе расходится столь значительно (а две мутации в DYS388 - это немало), то наука только выиграет. В этом будет и наш небольшой вклад, потому что привлекли внимание к тому, что Томас, судя по всему, не знал, и о чем, возможно, напишет.

Естественно, попгенетики это обсуждать не будут, они этого делать патологически не умеют. Школы потому что нет.


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 23.11.2012, 18:51
Сообщение #263


Легенда
************

Группа: R1a, Академики
Сообщений: 6904
Регистрация: 24.2.2009
Пользователь №: 1721



Цитата(aklyosov @ 24.11.2012, 0:16) *
Это - одно из возможных объяснений. Другое - банальная ошибка в типировании.

В любом случае, это даст возможность Т. Крану попытаться разобраться в вопросе, и сравнить свой образец шимпанзе-троглодита с тем троглодитом, что находится в европейской базе данных. Если число мутаций в каждом локусе расходится столь значительно (а две мутации в DYS388 - это немало), то наука только выиграет. В этом будет и наш небольшой вклад, потому что привлекли внимание к тому, что Томас, судя по всему, не знал, и о чем, возможно, напишет.

Там не только DYS388, который в медленной панели - один из самых быстрых маркеров, другие маркеры у двоих шимпанзе тоже расходятся. Повторяю их. Слева - Pan trogloditis Lyudmiia, справа P. trogloditis Thomas

DYS426 8 10 TTTTTTGTTGTTGTTGTTGTTGTTGTTGTT
DYS388 15 12
DYS438 5 5
DYS578 9 5.1
DYS641 10 10
DYS472 5 16 AATAATAATAATAATGATAATAATAATAGTAATAATAATAATAATAAT
DYS594 4 4.1
YS640 10 12
DYS492 9 10

Даже без спорных DYS426 и DYS472 набегает 10 мутаций на 7-ми маркерах. Столько раз ошибиться в типировании вряд ли возможно с тем опытом, как у Крана. Если шимпанзе - старый вид (я не знаю, так это или нет), то такое расхождение вполне реально, если эти самцы - из разных популяций. Это примерно тот же масштаб времен, что разделяет альфа- и бета-гаплогруппу. Возможно, несколько меньше из-за меньшей средней длины поколения у шимпанзе.


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
Люда
сообщение 23.11.2012, 20:54
Сообщение #264


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



Цитата
такое расхождение вполне реально, если эти самцы - из разных популяций

У Томаса это культура клеток фибробластов. Сell line NA03448, я нашла в интернете, получены в Coriell Institute for Medical Research. (Кстати, попались работы по сравнению последовательностей разных приматов).
В NCBI для whole genome shotgun использовали ДНК "коренного жителя" Зап.Африки -"Clint" (a captive-born descendant of chimpanzees from the West Africa subspecies Pan troglodytes verus) - сборка 2.1. В сборку 3.1 (тоже в NCBI) включена У-хромосома другого самца "Gon".


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
Люда
сообщение 23.11.2012, 21:38
Сообщение #265


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



Думаю, в основном, разница в способах подсчета. Например,
DYS426 8 10
GTTGTTTTTTTGTTGTTGTTGTTGTTGTTGTTGTT
Вот и получилось 10. По рекомендациям для подсчета повторов их считают вместе, если они прерываются количеством нуклеотидов не больше повторяющегося мотива. Здесь мотив-3, прерываются - 5(даже не 3х2), значит считать следует без первых 2х. На самом деле номенклатура эта в стадии становления и считают довольно произвольно для каждого DYSa (такое впечатление).


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
Люда
сообщение 24.11.2012, 9:30
Сообщение #266


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



Относительно DYS594. Впервые описан Kayser et al. (2004), в дальнейшем его изучали
Butler et al. (2006) and Lim et al. (2007). В 2006 YSFG (international Society for Forensic
Genetics) рекомендовала для DYS594 мотив - TAAAA (Gusmão et al., 2006; Butler et al., 2006). Так [TAAAA]n он представлен в базе данных http://www.genebase.com/in/dnaMarkerDetail...tr&m=DYS594
Однако больше повторов можно насчитать, если начать счет с AAATA, тогда получится
[AAATA] n+AAAAA, по существующим правилам 1-нуклеотидная замена допускается при подсчете количества повторов. Тогда DYS594 будет записан как N.1 повторов. Однако все же NIST ( U.S. National Institute of Standards and Technology, 2008) рекомендует использовать только AAATA мотив, без AAAAA.
Вывод: у Томаса DYS594 =4.1 (считали наверно AAATA(4)+ AAAAA)
Мы считали DYS594 =4 (TAAAA).
Думаю, DYS594 у нашим шимп. одинаков.


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
Igor1961
сообщение 24.11.2012, 11:22
Сообщение #267


Легенда
************

Группа: R1a, Академики
Сообщений: 6904
Регистрация: 24.2.2009
Пользователь №: 1721



Это все пока предположения - мы не знаем, как выглядела последовательность, с которой работал Томас. Те, с которыми работали мы, опубликованы в последней статье в Advances in Anthropology. Так что он сам может все проверить, было бы желание.


--------------------
Y-DNA: R1a M458>Y2604>CTS11962>L1029>FGC66323>YP1703>YP6189>BY35612
mt-DNA: U3a2a (16343G, 16390A, 16519C, 73G, 150T, 200G, 263G, 315.1C)
Перейти в начало страницы
 
+Цитировать сообщение
Люда
сообщение 24.11.2012, 15:24
Сообщение #268


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



Прошлась еще раз по тем DYSам, на которые указывал в сообщении №263 Игорь Львович. В некоторых случаях можно предположить, в чем причина разного счета (как правильно-?), в некоторых - необъяснимо.

DYS426=[GTT]8, Томас -10 возможно, считали [GTT]2 T5 [GTT]8
DYS388=[ATT]15 - наш счет (других вариантов нет), Томас – 12
DYS438= [TTTTC]3[TTTTG]1[TTTTC]1 =5=5
DYS578=[AAAT]9- наш счет (других вариантов нет), Томас –5.1
DYS641=[TAAA]10=10
DYS472=[AAT]5, Томас -16. Над этим случаем мы спорили на форуме. 16 получится, если считать, следуя номенклатуре - [AAT]5 [GAT]1 [AAT]3 [AGT]1 [AAT]6.
DYS594=[TAAA]4, Томас-4.1 возможно считали [AAATA]4 [AAAAA]1
DYS640=[TAAA]2 [CAAA]1 [TAAA]6 [CAAA]1 =10 , Томас-12 возможно считали [TAAA]2 [CCAA]1 [TAAA]6 [CAAA]1 [CCAA]1 [CCCA]1
DYS492= [TTA]9- наш счет (других вариантов нет, четкая делеция 2х триплетов, далее-полная гомология), Томас –10


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 24.11.2012, 15:48
Сообщение #269


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



В целом выглядит так, что у Томаса в приятелях другие шимпанзе.


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Люда
сообщение 25.11.2012, 8:06
Сообщение #270


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



Обнаружила небольшую ошибку у нас в статье. DYS578 у шимп. правильно выделен красным цветом повтор АААТ (9) , далее по ошибке записан еще 1 АААТ, его нет и мы его не считали-ошибка при написании.


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
Люда
сообщение 25.11.2012, 16:55
Сообщение #271


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



From: "Lawrence Mayka" Rootsweb
http://www.prweb.com/releases/prweb2012/11/prweb10166775.htm
'Bigfoot' DNA Sequenced In Upcoming Genetics Study
Five-Year Genome Study At DNA Diagnostics Yields Evidence of Homo sapiens/Unknown Hominin Hybrid Species in North America


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
Люда
сообщение 25.11.2012, 17:06
Сообщение #272


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



Сообщают, что несколько лет изучают ДНК Снежного человека - гибриды неизвестного гоминида(мужская линия) с чел.(жен.линия) из Сев.Америки.
???
Как поняла, из нескольких волосков, слюны выделены 20 мито-геномов и 3 полных ядерных генома-смесь человеческой ДНК и ДНК ни на что не похожей.
Пока никаких результатов миру не предъявлено.


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
Люда
сообщение 27.11.2012, 20:52
Сообщение #273


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



Возвращаясь к своим проблемам:
По снипам, отмеченным желтым цветом (как требующим проверки) в презентации Thomas Kranh, можно сказать следующее:
L1092 - 3-аллельный снип (А00 – T, A1- G, шимпанзе, горилла, орангутанг –на Хромосоме– А). Если ставим его на линии А00,
то также надо ставить в А1 c другим значением нуклеотида.
L1113- cнип А00
L1114 - не снип А00 (шимпанзе и A00-G)
L1099 - 3-аллельный снип (А0 – G, шимпанзе-А, V150 в A0 - та же позиция – С)
V176 - в Ухромосоме шимпанзе и А1- С, в Хромосоме шимп.-Т. Если у A0 – Т, то это его снип
Остальные ”желтые” снипы, кажется, не противоречат данным NCBI
V157 – снип А0 –Т, шимп. –А
P305 –снип А1
L1070 – снип А0 (С), шимп.-G
L1073 – снип А0 (С), шимп.-Т
L1075 – снип А0 (Т), шимп.-С
L1076 – снип А0 (A), шимп.-G
L1078 – снип А0 (A), шимп.-C
L1079 – снип А0 (T), шимп.-C
L1080 – снип А0 (С), шимп.-T
L1081 – снип А0 (A), шимп.-Т
L1082 – снип А0 (G), шимп.-A


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 27.11.2012, 22:36
Сообщение #274


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



>Если у A0 – Т, то это его снип

Откуда у Вас появилось такое забавное сочетание A0-T?

То есть линия прямо от А0 до Т?



--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Люда
сообщение 28.11.2012, 7:21
Сообщение #275


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



Правильно В.Юрковец понял - буква это нуклеотид.


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
aklyosov
сообщение 28.11.2012, 17:29
Сообщение #276


Легенда
************

Группа: R1a, Академики
Сообщений: 8858
Регистрация: 4.7.2008
Пользователь №: 526



Напомню, откуда этот курьез пошел.

>Откуда у Вас появилось такое забавное сочетание A0-T?
>То есть линия прямо от А0 до Т?


Поскольку Людмила на это не ответила, по поясню. Сочетание A0-T, A0-R и так далее употребляется для обозначения генеалогических линий от А0 до соответствующих гаплогрупп, что на самом деле никогда не наблюдалось. Только что Stanislaw на Форуме Родство завел про линию A0-R. Так что это сокращение уже занято другими понятиями.

Путаница произошла от того, что Людмила вместо А0 (T), как она обычно обозначает нуклеотиды, написала А0-Т. Это еще раз показывает, что к записям следует относиться внимательно.

А эту цепь выяснений в самом деле нужно удалить. Вскоре я это сделаю.


--------------------
Y-DNA: R1a-Z283
mt-DNA: H

Перейти в начало страницы
 
+Цитировать сообщение
Люда
сообщение 29.11.2012, 16:18
Сообщение #277


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



Продолжаю выяснять у Thomas Krahn то, что мне непонятно по снипам А00. Думаю, что количество их, правильное отнесения к ветвям будет в дальнейшем важно. На вопрос о L0192, который тоже кажется 3-аллельным(А00 – T, A1- G, шимпанзе, горилла, орангутанг –на Хромосоме– А). Мне казалось, если ставим его на линии А00,то также надо ставить в А1 c другим значением нуклеотида.
Thomas ответил:
"Yes, I marked L1092 as one of problematic markers becouse we didn't yield PCR products for chimp & gorilla with V172 primers at all. I'm not sure if I'd place another mutation event in the A0-T branch because it's muchmore likely that such a mutation would have happened in the human specific branch, long before A00 split off. The likelihood that such a mutation happened there is so much higher because the time span is significantly longer (to the chimp split) than the intersection between A00 and A0-T.
We are sure that there is no change of L1092 status in A1 because our A0a1a-P114 sample is G (ancestral in my definition)."

Понятно, если у A0a1a-P114 как и у А1 тоже -G, то это общий наш с ними снип (данные по A0a1a-P114 получены Томасом - проверка снипов Перри, для нас пока были неизвестны). Но когда прошла эта мутация, все-таки остается неизвестно. У общего нашего с А00 предка, или ancestral - как у шимп.-А, а в 2х линиях независимые мутации?


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
Боромир
сообщение 29.11.2012, 21:50
Сообщение #278


Эксперт
*****

Группа: R1a, Магистры
Сообщений: 1469
Регистрация: 2.4.2009
Из: Бостон
Пользователь №: 1923



Цитата(Люда @ 29.11.2012, 9:18) *
На вопрос о L0192, который тоже кажется 3-аллельным(А00 – T, A1- G, шимпанзе, горилла, орангутанг –на Хромосоме– А). Мне казалось, если ставим его на линии А00,то также надо ставить в А1 c другим значением нуклеотида.

Насколько помню в названиях первоначальных статей по рассматриваемой тематике выражение "биаллельный маркер" было must have, т.е. в ДНК генеалогии полиаллельные маркеры не рассматривались по определению из-за их бесполезности (в ДНК генеалогии). Видимо, в контексте прокси-шимпанзе снип L0192 надо выкинуть из рассмотрения. Вернуться к нему, снова будет можно с прокси-неандерталец, где L0192 будет биаллельной парой Т-G (если будет). Я так понял, что Томас завуалированно намекнул на это же, утверждая, что время до общего предка человека-шимпанзе очень велико. "The likelihood that such a mutation happened there is so much higher because the time span is significantly longer (to the chimp split) than the intersection between A00 and A0-T."


--------------------
FTDNA Kit No. 143121, Russian Empire Project
Ysearch/mitosearch URQ2X


--------------------
Y-DNA: R1a-Z280 >CTS1211>CTS3402>Y33>CTS8816>Y2902>Y2910>L458* Восточно-Карпатская (Волго-Карпатская ветвь)
mt-DNA: H* (16085T, 16189C, 16519C, 263G, 315.1C, 522-, 523-)
Перейти в начало страницы
 
+Цитировать сообщение
Люда
сообщение 1.12.2012, 21:54
Сообщение #279


Знаток
****

Группа: Mt Helena
Сообщений: 619
Регистрация: 1.1.2010
Пользователь №: 2612



Боромир
Цитата
в ДНК генеалогии полиаллельные маркеры не рассматривались по определению из-за их бесполезности (в ДНК генеалогии).

Теперь рассматриваются. Про V161.1, V161.2 пишут "triallelic polymorphism". Вы рекомендовали эту статью R.Scorzzari,...F.Cruciani Molecular dissection of the basal clades in human Y chromosome phylogenetic tree.
PLOS ONE nov.2012 v.7 iss.11.


--------------------
муж: Y - J2-L24(L590), митоДНК - F1b
зять1: Y - R1a1 (L784)
зять2: Y - R1a1 (YP331)

--------------------
mt-DNA: H6a1a5
Y-DNA: R1a.L365+ & mt-DNA: V1a (отец)
Перейти в начало страницы
 
+Цитировать сообщение
karandasov
сообщение 12.3.2013, 21:50
Сообщение #280


Новичок
*

Группа:  Y - ???
Сообщений: 20
Регистрация: 30.3.2009
Из: Москва
Пользователь №: 1907



На всякий случай, вот свежая статья в American Journal of Human Genetics

An African American Paternal Lineage Adds an Extremely Ancient Root to the Human Y Chromosome Phylogenetic Tree
Перейти в начало страницы
 
+Цитировать сообщение

15 страниц V  « < 12 13 14 15 >
Быстрый ответОтветить в данную темуНачать новую тему
1 чел. читают эту тему (гостей: 1, скрытых пользователей: 0)
Пользователей: 0

 

              Mantlet IPB skin Designed by Fisana, IPBskins.ru
RSS Текстовая версия Сейчас: 19.9.2019, 3:48
 
     




Генеалогический сайт Рунета Сайт Всероссийского Генеалогического Древа Генеалогическая сеть Анализ фамилий Cайт рода R1a Краеведческий сайт Чеченский ДНК проект


© 2004-2015 RODSTVO.RU