Главная   |   Древние Рода   |   ДНК тесты   |   ДОК генеалогия             VK  |  OK  |  FB

Здравствуйте, гость ( Вход | Регистрация )

Ответить в данную темуНачать новую тему
> Митогруппы (результаты палео-днк)
сообщение 24.2.2009, 10:27
Сообщение #1


Группа: N
Сообщений: 2194
Регистрация: 8.7.2008
Из: Москва
Пользователь №: 547

Насколько я понимаю, это - результаты по Иисусу Хрису и Марии Магдалине?
Никто не знает - сказки это или результаты каких-то исследований?
List of DNA tested mummies
Name Location Approximate lifetime Mitochondrial DNA sequence mtDNA Haplogroup Y-DNA Haplogroup
Yeshua bar Yehosef Israel 2,000 years ago 270G, 278T ? ?
Mariamene e Mara Israel 2,000 years ago 290G ? —

Y-DNA: [/color][color="#ff00ff"]N1с1*; M214(rs2032674); P188(rs16980610); P192(rs16980641); P193(rs16980426); P194(rs16980363); P195(rs2196155); M231(rs9341278); LLY22g; Tat(M46, rs34442126)+; P105+; M178(i3000046)+; P298; P21-; P67-; P119-
YSearch: KABEC
FamilyTree: 106620
CCR5 [/size][size="1"]del32
Перейти в начало страницы
+Цитировать сообщение
Павел Шварев
сообщение 24.2.2009, 12:27
Сообщение #2


Группа: Главные администраторы
Сообщений: 11619
Регистрация: 22.4.2008
Из: порт Находка
Пользователь №: 2

Получается, что по женским линиям уже можно вычислять родство с Иисусом?
Перейти в начало страницы
+Цитировать сообщение
сообщение 24.2.2009, 12:31
Сообщение #3


Группа: N
Сообщений: 2194
Регистрация: 8.7.2008
Из: Москва
Пользователь №: 547

Если бы была ссылка на статью, то я, может быть, и поверил бы.
Пока же для меня это - выяснение: сказка (типа Кода ДаВинчи) или исследование.

Y-DNA: [/color][color="#ff00ff"]N1с1*; M214(rs2032674); P188(rs16980610); P192(rs16980641); P193(rs16980426); P194(rs16980363); P195(rs2196155); M231(rs9341278); LLY22g; Tat(M46, rs34442126)+; P105+; M178(i3000046)+; P298; P21-; P67-; P119-
YSearch: KABEC
FamilyTree: 106620
CCR5 [/size][size="1"]del32
Перейти в начало страницы
+Цитировать сообщение
сообщение 20.8.2009, 18:39
Сообщение #4



The Discovery Channel show did not give any raw data, but a posting at the
FTDNA forum gave results in this format:

"The book [presumably "The Jesus Family Tomb"] had the following mtDNA
sequences listed:



140 (partial)
CTACCC - Jesus
ACCTAG - Mariamne"

The two sequences are not aligned with each other, but they overlap. I
realigned them and deduced the polymorphisms by comparing the fragments with the
CRS. You will need to view this in a fixed width font (or look at this post in
the archives) to make the letters and numbers line up:

acccactaggataccaacaaacctaccc CRS starting at 16265

Jesus 16270G 16278T
Mariamne 16290G

I ran the sequences at BLAST. The polymorphisms are common enough that they
show up in multiple haplogroups (parallel mutations), so the sequences are too
short to make any statement about a haplogroup. The only conclusion we can
draw is that the two sequences are not matrilineally related.

Ann Turner
Перейти в начало страницы
+Цитировать сообщение
сообщение 20.8.2009, 18:40
Сообщение #5




I just have to comment on this whole subject.....Until complete,
thorough and exhausted testing is performed on the entombed and the data
is solid within the existing confines of science, spectulation is the
only consensus here. Plus, in lieu of that fact that there is no
existing data on Jesus Christ's DNA as of yet, it will remain so.
My issues are with the media alluding to that this is the actual tomb of
Jesus Christ while titling the coverage of this story with the given
name from the tomb, "Jesus" and paralleling the other internees with the
family of Christ. I know many people today who's given names are
"Jesus", as I am sure, many were so named back in the time of this tomb.
This must be treated for just what it is: a forensic challenge and
anthropolical mystery to be studied, not exploiting the public and
history with sensationalism and a possible falsehood for the everloving
Перейти в начало страницы
+Цитировать сообщение
сообщение 21.8.2009, 19:01
Сообщение #6


Некий John Caggegi-Raciti (мито гаплогруппа U) зарегистрировался 3 раза на mitosearch.org и упомянул там родство с Иисусом.
Перейти в начало страницы
+Цитировать сообщение
сообщение 21.8.2009, 19:51
Сообщение #7


Скорее всего, фантазёр-самозванец smile.gif
Перейти в начало страницы
+Цитировать сообщение

Быстрый ответОтветить в данную темуНачать новую тему
1 чел. читают эту тему (гостей: 1, скрытых пользователей: 0)
Пользователей: 0


              Mantlet IPB skin Designed by Fisana, IPBskins.ru
RSS Текстовая версия Сейчас: 24.7.2019, 12:08

Генеалогический сайт Рунета Сайт Всероссийского Генеалогического Древа Генеалогическая сеть Анализ фамилий Cайт рода R1a Краеведческий сайт Чеченский ДНК проект

© 2004-2015 RODSTVO.RU