Помощь - Поиск - Пользователи - Календарь
Полная версия этой страницы: Гаплoгрупа A И Mrca Современного Человека
Rodstvo.ru > Y-гаплогруппы (мужские линии) > Рода A и B
Страницы: 1, 2
Stanislaw
Гаплoгрупа A важная каждому антропологу и гэнэалoгy Y-DNA !.
Hаверно она представляет собой выходную популяцию для современного человека.
Показывает на единство человеческого рода и делает вожможный подсчитывание времени его общего предка, т. наз. ”хромосомного Адама”.

Гаплoгрупа A к сожалению по-прежнему мало узнана.
Мы в базе Ysearch находим с этой гаплoгрупы едва 52 гаплoтыпы. В этом только семь тестированных в 67 маркерах; пять из их принадлежать одной семье (Boyd).
Поэтому эти очень провизорные и неактуализированные находятся в ISOGG:
http://www.isogg.org/tree/ISOGG_HapgrpA.html

Вследствие работы F.Cruciani et al. (май) 2011 интерес гаплoгрупом A очень возросл.
Cruciani et al:
”A Revised Root for the Human Y Chromosomal Phylogenetic Tree--The Origin of Patrilineal Diversity in Africa.”
http://www.cell.com/AJHG/abstract/S0002-9297%2811%2900164-9

Узнали так как, хотя может не в конце концов, наиболее старые мутации, специфическое для гаплoгрупы A и серию семь их мутаций, которые вместе с тем общие для гаплoгруп позаафрыканьских (определять символом А1а-Т).
Теперь FTDNA и Т. Krahn в пределах тестировать WTY пользуются с открытыми от Cruciani SNP со символом ” V " африканских мутаций, и особенно этот из их, который вместе с тем общие населению позаафрыканьскей: V168, V171, V174, V203, V238, V241, V250
http://ytree.ftdna.com/index.php?name=Draft

В ” Y Haplogroup A Project”"
http://www.familytreedna.com/public/Haplogroup_A
собрали все примерно 62 тестировaных с гаплoгрупы A, в этом примерно 30 67-маркэровых.
На этой стороне появляются и сообщения о тестах новo открытыx мутаций через Cruciani. Следуют их переаттестация и идентификация с мутациями раньше открытыми.

Cruciani, имея в своем распоряжении свои новый-открытый мутации SNP (”V” символ), начерно подсчитал возраст хромосомного Адама, предка гаплoгрупы А1b (африканской) и А1а-Т (общей африканской и позаафрыканьскoй) на примерно 142 тысячи лет (безотносительно к Cruciani датировке этот гаплoгруп посвятили статьи во Вестникe (Tom 4, No 5, 992-997; Tom 4, No 7, 1367-1375; 1495-1502).

Так как на форум Rodstvo.ru часто ухаживает не верить этому, что написанное и ” автоматически прокручивать альтернативы ", я попробовал датировки, используя только 67-маркэровыми гаплoтыпами из базы Ysearch.
Поданное через Ysearch GD общего предка (MRCA) я уменьшал на стандартных 5 процентов в пользу многоступенчатых мутаций.
Я время MRCA читал (без никакой акробатики!) прямо из доски PCM/FMT.
Застигает высокий результат рода Boyd (фамилии Boyd, Vest, Rey) с субгрупы А3b2, о чем уже сигнализировал уважаемый Игорь.

Результаты
Bремя MRCA всёx 67-маркэровых гаплoтыпoв A в Ysearch - 105,500 лет.
Bремя MRCA гаплoтгыпoв A и 22 пжедставцельи гаплoгруп позаафрыканьских - 87,200 лет
Bремя MRCA семьи Boyd и групп позаафрыканьских - 101,600 лет.
Максимальное время MRCA рода Boyd и несколько позафрыканьских Y-DNA - 142,000 (как у Cruciani!)
aklyosov
Уважаемый Stanislaw,

К сожалению, Вы так и не поняли НИЧЕГО из того, что Вам объясняли.

Я Вам предлагаю назвать шимпанзе "гаплогруппой А", и тогда мы все автоматически окажемся в гаплогруппе А.

И то будет проблема - неандерталец тогда тоже окажется в гаплогруппе А, а его в Африке не было. Как Вы это перенесете?

Откуда у Вас такая страсть все подгонять под Африку? - даже когда Вам объяснили, что носителей М91 у нас нет. А это и есть гаплогруппа А. У нас нет снипов ни койсанов, ни пигмеев - а это тоже гаплогруппа А. Это Вас не беспокоит?

А то, что гаплогруппа А важна "каждому антропологу", это и так ясно. Знать вообще полезно.

aklyosov
Цитата(Stanislaw @ 20.11.2011, 15:21) *
я попробовал датировки, используя только 67-маркэровыми гаплoтыпами из базы Ysearch.
Поданное через Ysearch GD общего предка (MRCA) я уменьшал на стандартных 5 процентов в пользу многоступенчатых мутаций.
Я время MRCA читал (без никакой акробатики!) прямо из доски PCM/FMT.
Застигает высокий результат рода Boyd (фамилии Boyd, Vest, Rey) с субгрупы А3b2, о чем уже сигнализировал уважаемый Игорь.

Результаты
Bремя MRCA всёx 67-маркэровых гаплoтыпoв A в Ysearch - 105,500 лет.
Bремя MRCA гаплoтгыпoв A и 22 пжедставцельи гаплoгруп позаафрыканьских - 87,200 лет
Bремя MRCA семьи Boyd и групп позаафрыканьских - 101,600 лет.
Максимальное время MRCA рода Boyd и несколько позафрыканьских Y-DNA - 142,000 (как у Cruciani!)


Ну и что? Вы нашли (правда, очень сомнительным способом) что гаплотипы гаплогруппы А имеют общего предка 87,200-105,500 лет назад. Ну, дальше что? Что, по Вашему, это означает?

А это означает, что гаплотипы гаплогруппы А имеют общего предка 87,200-105,500 лет назад. Не более того. Мы это тоже нашли, и это опубликовано в Вестнике.

Правда, хотелось бы узнать, как это Вы нашли. Сколько было гаплотипов, сколько мутаций, и какую Вы использовали константу скорости мутации. Ну пусть даже так. Причем здесь неафриканские гаплотипы, если у них нет африканских мутаций, в первую очередь М91? Откуда Вы вдруг решили, что V168 - это африканская мутация? Нашли у древнего ископаемого африканца? Или просто взяли с потолка? Расскажите, пожалуйста.

То, что Вы делеаете, называется "манипуляция". Причем в негативном смысле.
Igor1961
Честно говоря, я не очень понял, что хотел доказать пан Станислав, а потому предлагаю снова вернуться к сопоставлению снипов ISOGG (индексы M и P) и Cruciani (индексы V). На гаплогруппном проекте на настоящий момент есть 3 участника, что имеют результаты тестов по обеим системам.
Это
N38376 Jones M91+, P97+, P108-, P82-, M23-, M32-, M42-, SRY10831.1-; V151-, V50-, V168-, V171-, V221-
181787 Gage M91+, P97+, P108-, P82-, M23-, M32-, L604+, M42-, SRY10831.1-; V50+, V151-, V171+, V221+
180250 Phillips M91+, P108+, M31+; V168+, V171+, V221-

Красным цветом отмечены снипы, входящие для гаплогруппы А, что отрицательны для всех остальных гаплогрупп, синим - входящие для бета-гаплогруппы (ВТ), общий предок которой датируется временем около 60 тыс. лет назад.

Нетрудно видеть, что все 3 участника по нотации ISOGG однозначно попадают в гаплогруппу А. Из них Phillips имеет положительный тест на снипы субклада А1 (Р108) и А1а (М31). Jones и Gage, в свою очередь, дали негативные тесты на субклады А1 (P108), А2 (M23) и А3 (М32), что помещает их в парагруппу A*. Все 3 джентльмена по ген. дистанциям на 37 маркерах составляют треугольнок со сторонами 48 (Jones-Phillips ), 48 (Phillips-Gage), 58 (Jones-Gage). Это чудовищный разброс по времени, особенно хорошо видный, если сравнить гаплотипы по 6-ти медленным маркерам. Для тех же самых пар имеем расхождение на 10, 9 и 5 мутаций соответственно. Это явно больше 100 тыс. лет до общего предка, без всякой акробатики.

Что теперь говорит схема снипов Cruciani для той же троицы? Во-первых, Jones вообще вылетает из классификации, поскольку он дал негативные результаты на "обновленные" субклады A1b (V151), А1а-Т (V168, V171), А2-Т (V221) и А2 (V50). Во-вторых, Gage по новой схеме классифицируется как А2 (V50+), что подтверждается положительными снипами на вышестоящие по иерархии А1а-Т (V171) и А2-Т (V221) и негативным на параллельный A1b (V151). Наконец, класссификация Phillips как А1а совпадает по обеим нотациям.

Что имеем в итоге? Имеем очевидный факт, что в коммерческих базах данных есть, как минимум, один обладатель гаплотипа, что по "научной" классификации располагается между шимпанзе и современными людьми, то есть ДО развилки A1b и А1а-Т. При этом у него, как и доказанных обитателей субкладов А1а и А2, имеются в наличии снипы М91 и Р97, что маркируют гаплогруппу А как отдельно стоящую от всего остального древа.

Следовтельно, неизвестный автор статьи в Википедии, поместивший снипы М91 и Р97 между А3 и ВТ, прибег к откровенному подлогу. Экспериментальные данные полностью опровергают эту конструкцию.
Stanislaw
Спасибо, уважаемый пан Игорь!
Я благодарю за анализ новых тестов в гаплoгрупе А.
Тестированиe очередных снипов Dorsey, Gage, Jones, Boon, Phillips и другиx из верхушки гаплoгрупы A по-прежнему продолжается...
Из дискуссии близкой среды Krahna (Bonie):
http://dna-forums.org/index.php?/topic/154...on/page__st__20
вытекает, что
Позиция снипов М91 и М97 на дереве по-прежнему не надежныя и не окончательная.
Мы увидим.
Важное тоже это, что в гаплoгрупе A мы находим мутации А1-Т.
Цитата
Это чудовищный разброс по времени, особенно хорошо видный, если сравнить гаплотипы по 6-ти медленным маркерам. Для тех же самых пар имеем расхождение на 10, 9 и 5 мутаций соответственно. Это явно больше 100 тыс. лет до общего предка, без всякой акробатики.
У вас полное доверие к своей технике считания времени мутации?

aklyosov
Цитата(Igor1961 @ 21.11.2011, 5:12) *
Честно говоря, я не очень понял, что хотел доказать пан Станислав...
(...)
Что имеем в итоге? Имеем очевидный факт, что в коммерческих базах данных есть, как минимум, один обладатель гаплотипа, что по "научной" классификации располагается между шимпанзе и современными людьми, то есть ДО развилки A1b и А1а-Т. При этом у него, как и доказанных обитателей субкладов А1а и А2, имеются в наличии снипы М91 и Р97, что маркируют гаплогруппу А как отдельно стоящую от всего остального древа.

Следовтельно, неизвестный автор статьи в Википедии, поместивший снипы М91 и Р97 между А3 и ВТ, прибег к откровенному подлогу. Экспериментальные данные полностью опровергают эту конструкцию.


Очень хорошо. На самом деле, уже доказано разными способами, что гаплогруппа А стоит отдельно (вилкой) от всех остальных гаплогрупп, и все остальные группы от нее НЕ ПРОИСХОДЯТ. Здесь стоит четко определить, что такое "гаплогруппа А". Это - гаплогруппа, задаваемая снипами М91 и Р97, которые есть объективная реальность, и находятся в Y-хромосомах многих африканских негроидов.

Я здесь специально пишу "африканских негроидов", потому что в Африке живут и египтяне, и ливийцы, и потомки южноафриканских буров, то есть британцев, голландцев и прочих европейцев.

Это не мы первые нашли, что эти африканские негроиды гаплогруппы А не являются нашими предками. К этому мучительно приходила классификация ISOGG. Вот как это происходило:

В 2006 году было практически общепризнано, что африканская гаплогруппа А является «корневой», от которой произошли все другие гаплогруппы Y-хромосомы. На дереве гаплогрупп 2006 года (http://www.isogg.org/tree/ISOGG_YDNATreeTrunk06.html) в сводке данных ISOGG (Международного общества генетической генеалогии) первые несколько гаплогрупп подавались следующим образом:

• A M91
• BR SRY10831.1 (SRY1532), M42, M94, M139, M299
• • B M60, M181
• • CR M168, M294, P9

Подпись гласила: «The BR haplogroup split off from haplogroup A 55,000 years before present (bp). It probably appeared in North East Africa» (гаплогруппа BR отделилась от гаплогруппы А 55 тысяч лет назад. Это вероятно произошло в северо-восточной Африке». Индексы справа соответствуют специфическим мутациям (SNP, см. выше), присущим данным гаплогруппам. То есть эта схема показывала, что снип М91 определяет и гаплогруппу А, и якобы все последующие гаплогруппы от В до R, что, конечно, означало бы, что все неевропейские гаплогруппы – производные африканских. Но это оказалось неправдой, как будет показано ниже.

То есть смотрите, как интересно. На схеме уже показано, что гаплогруппа А параллельна гаплогруппе BR (или это просто так неудачно нарисовали), но подпись ясно говорит о том, что BR произошла от А. Может у них схемы делают одни люди, а тексты пишут другие? Как бы то ни было, ISOGG провозглашали, что все другие гаплогруппы - производные гаплогруппы А. Тогда у А был идентифицирован только один снип - М91.

В номенклатуре 2007 года все осталось так же. И дерево, и подпись.

В 2008 году дерево несколько изменилось:

Y
• A M91, P97
• BT SRY1532.1/SRY10831.1, M42, M94, M139, M299
• • B M60, M181, P85, P90
• • CF M168, M294, P9.1

Но подпись осталась той же: «The BR haplogroup split off from haplogroup A 55,000 years before present (bp). It probably appeared in North East Africa». Кстати, появился еще один входной снип гаплогруппы А - Р97.

Номенклатура 2009 и 2010 года – точно то же самое, что 2008 года. И дерево, и подпись.

Номенклатура 2011 года – дерево почти то же самое, кроме того, что сводную гаплогруппу CF заменили на СТ:
Y
• A M91, P97
• BT Page65.1/SRY1532.1/SRY10831.1, M42, M94, M139, M299
• • B M60, M181/Page32, P85, P90
• • CT M168, M294, P9.1

Но слова уже принципиально другие: «The BT haplogroup split from the root of the Y haplogroup tree 55,000 years before present (bp), probably in North East Africa. The root of the Y haplogroup tree is the so-called "Y-Chromosome Adam," the most recent patrineal ancestor of all people living today, who is believed to have lived 60,000 to 90,000 years ago... The A haplogroup is thought to have been defined about 60,000 years bp».

Иначе говоря, согласно описанию 2011 года, африканская гаплогруппа А уже не является предком современного человечества. В схему вводится «хромосомный Адам», который жил между 90 и 60 тыс лет назад, от него образуется гаплогруппа А 60 тыс лет назад, а гаплогруппа В образовалась от кого-то 55 тысяч лет назад, от кого – не понять, написано уклончиво. От кого образовалась неафриканская гаплогруппа С – тоже непонятно, и в номенклатуре не пояснено – то ли от африканской гаплогруппы В, то ли от сводной гаплогруппы ВТ, независимо от В. Если последняя версия – то неафриканские гаплогруппы вообще не потомки африканских гаплогрупп, если не вводить дополнительные допущения и постулаты.

Как показано нами – верен именно последний вариант, не произнесенный в номенклатуре ISOGG. Неафриканские гаплогруппы не являются потомками африканских гаплогрупп А и В. Как показано в наших работах (Клёсов, 2011; Клёсов и Рожанский, 2011), гаплогруппа А идет двумя рукавами с древнейших времен, и это скорее всего две разные гаплогруппы, просто объединенные под названием «А» без всяких оснований. На этом пути из древнейших времен есть гаплогруппа (бета-гаплогруппа, 64 тыс лет назад) от которой в сторону уходит африканская (в настоящее время) гаплогруппа В (46 тыс лет назад) и в другую сторону – все неафриканские гаплогруппы. Ни одна из них не происходит от гаплогрупп А или В (Клёсов, 2011). Более того, ни один из тестированных (на снипы) носителей неафриканских гаплогрупп (Проект Walk Through Y) не имеет снипов африканских гаплогрупп А и В. Место происхождения бета-гаплогруппы остается пока неизвестным, но ничто не указывает на ее африканское происхождение, и во всяком случае не указывает ни физическая антропология большинства потомков этой бета-гаплогруппы, ни картина снипов.

Так что и ISOGG теперь понимают, что гаплогруппы BT не произошли от африканской гаплогруппы А.

Но теперь начинается весьма забавное. Никто не решается это произнести. Потому что это уже стало неполиткорректным. Начинается акробатика, как все-таки и рыбку съесть, и показать, что все европейцы и азиаты имеют африканское происхождение. Ведь все академические статьи на эту и близкую темы начинаются словами "как известно, современный человек имеет африканское происхождение", "...вышел из Африки...", и тому подобное. Вот акробатика и призвана как-то это продолжить, иначе страшно.

Действие первое - идет проект WTY (Walk Through Y-chromosome). Ясно видно, что ни у одного носителя гаплогрупп от В до Т нет снипов М91 и Р97. Но авторы проекта об этом как воды в рот набрали. Включая Томаса. Об этом - ни звука. Потому что страшно произнести. Приходится заметать под ковер.

Действие второе. Выходит статья Крусиани. В названии статьи - "Африканское происхождение" (The Origin of Partilineal Diversity in Africa). Что в статье? Взяли нескольких пигмеев и койсанов, куда уж как не Африка, и показали, что у них - совершенно отдельная ветвь. Снипа М91 у них действительно нет. Начинается акробатика - их все равно отнесли к гаплогруппе А, и Крусиани объявил, что снип М91, возможно, нестабильный. Помните, про неправильных пчел? Ну а как иначе подогнать всех под Африку? И Крусиани предположил, что М91, может, переехал, и "на самом деле" он может быть, наверное, семь на ум пошло, является входным в гаплогруппу ВТ, и тогда - ура! - все происходят из Африки! И какой-то услужливый хмырь в Википедии тут же вставил это как факт.

Вот так у попгенетиков делается наука.

На самом деле Крусиани нашел ряд особенно древних снипов, которые относятся к альфа-гаплогруппе или даже ранее, и действительно относятся ко всем, и к части африканцев, и к неафриканцам. V168 - один из таких снипов. Возможно, это снип альфа-гаплогруппы, от которой потом отщепились африканцы. Но даже не у всех африканцев этот снип есть. То есть это снип явно не от шимпанзе, а приобретен по пути. Интересно, есть ли он у неандертальцев. Никакого указания на Африку в нем нет.

Последний вопрос. Мне тоже непонятно, что хочет "показать" уважаемый Stanislaw. Он здесь выкрикивает лозунги, типа "ура, мы из Африки", "пигмеи - современные люди", "антропологам нужно знать гаплогруппу А" и прочее, но при том демонстрирует совершенное непонимание филогении и ее отнесения. Понятно, что живущие СЕЙЧАС пигмеи - современные люди, они живут сейчас, в 2011 году. Просто по определению.

И еще. Священная корова попгенетиков, что "где разнообразие - там и прародина", на которой (корове) они галопируют почем зря, опять демонстрирует, что молока у нее нет. Разнообразие - это древность или смешивание разных линий, но далеко не всегда "прародина". Африка - прародина для многих африканцев, но не для нас с Вами, по крайней мене на протяжении последних 100 тысяч лет. Потому мы и не негроиды, и даже близко нет.
Stanislaw
Цитата(Igor1961 @ 21.11.2011, 14:12) *
Нетрудно видеть, что все 3 участника по нотации ISOGG однозначно попадают в гаплогруппу А. Из них Phillips имеет положительный тест на снипы субклада А1 (Р108) и А1а (М31). Jones и Gage, в свою очередь, дали негативные тесты на субклады А1 (P108), А2 (M23) и А3 (М32), что помещает их в парагруппу A*. Все 3 джентльмена по ген. дистанциям на 37 маркерах составляют треугольнок со сторонами 48 (Jones-Phillips ), 48 (Phillips-Gage), 58 (Jones-Gage). Это чудовищный разброс по времени, особенно хорошо видный, если сравнить гаплотипы по 6-ти медленным маркерам. Для тех же самых пар имеем расхождение на 10, 9 и 5 мутаций соответственно. Это явно больше 100 тыс. лет до общего предка, без всякой акробатики.
Я вижу тоже интересующий квадрат GD гаплётыпов 67 маркэровых:
Unknow - Arnold:91,
Arnold - Perry: 91,
Perry - Dorsey: 90,
Dorsey - Unknow: 99

А его диагонали: 92 и 88.

Stanislaw
Цитата
На самом деле Крусиани нашел ряд особенно древних снипов, которые относятся к альфа-гаплогруппе или даже ранее, и действительно относятся ко всем, и к части африканцев, и к неафриканцам. V168 - один из таких снипов.
Так. Я писал только о том, что открыли общие отцовские мутации для африканского рода A (кроме ветви А1b) и для всех родов позаафрыканьских.
Что мы - одна человеческая семья.

Прежде - как в ISOGG - позаафрыканьскиe роды BТ были только как будто неопределенные братья для африканского рода А.
Мы теперь знаем уже отца для для оба групп.
Мы спрашиваем теперь, кто будет общим отцом для А1а-Т и для ”осироцeнeй” ветви А1b.
Эта мутация может быть уже известная, только неправильно вмещенная.
Или надо её открыть.

Во всяком случае этот предок ”пигмэёв” и ”непигмэёв” (например A1b и A1a-T) может быть накоротке временно, для этого показывает время мутаций теперь уже известных.
Это временное расстояние от общего предка наверное, когда уже увидели, не космическое!
Я об этом уже давно здесь писал.

Цитата
Мне тоже непонятно, что хочет "показать" уважаемый Stanislaw. Он здесь выкрикивает лозунги, типа "ура, мы из Африки", "пигмеи - современные люди", "антропологам нужно знать гаплогруппу А" и прочее,
Совсем мне не зависит к месту возникновения Адама. Может быть и под Кремлем. В самом деле!
Я скорее подвожу, что нет хромосомной причины выключания какой-либо человеческой известной группы из-под названия "современный человек".

aklyosov
Цитата(Stanislaw @ 21.11.2011, 14:01) *
Что мы - одна человеческая семья.

Я скорее подвожу, что нет хромосомной причины выключания какой-либо человеческой известной группы из-под названия "современный человек".


Поскольку Вы выделили эти два положения главным шрифтом, я понимаю, что это и есть Ваши главные положения.

Нужно было сразу так и сказать.

Нет проблем, мы - одна семья.

biggrin.gif

Даже когда племянник родился 160 тысяч лет назад. Все равно зачислим в семью.

Про второе я уже объяснил, Вы просто пошли по третьему кругу. Естественно, современный человек, а какой же? Живут в наше время. И челюсть на месте. Два уха, опять же. Какой же не современный?


Цитата(Stanislaw @ 21.11.2011, 14:01) *
Я писал только о том, что открыли общие отцовские мутации для африканского рода A (кроме ветви А1b) и для всех родов позаафрыканьских.


И про это я уже писал. Все мутации шимпанзе - тоже отцовские для нас. У нас их больше миллиона - от шимпанзе. Так что "отцовские мутации" - дело известное. Не это важно у Крусиани. А важно то, что он показал, что есть много мутаций, которые есть у гаплогруппы А, а у нас их нет. Поэтому мы - не потомки африканцев. Вот что важно. Мы потомки какого-то намного более древнего предка. Так что все равно одна семья. Мы и с шимпанзе одна семья, в самом деле.

Вот Вам стишок на память. Из серии "Мемуары".

Я и Дарвин

Нам от научных версий нет спасенья,
Любой идее нужен адресат…
Вот, помнится, однажды в воскресенье
Пошли мы с другом Чарли в зоосад.

Да, были закадычные друзья мы
Вплоть до того безрадостного дня,
Когда, увидев в клетке обезьяну,
Он стал в упор рассматривать меня.

Вертелись возле клеток чьи-то дети,
Гуляли старики и молодежь…
Сказал я: «Чарли, выкинь мысли эти!
Я понял, черт возьми, куда ты гнешь!

Да мало ль у кого какие рожи!
Ты, Чарли, соблюдай хотя бы такт.
Ну, ладно, допускаю, что похожи,
Но это вовсе не научный факт.

И без тебя немало неликвидов
В науке накопилось с давних пор.
Добавишь ты «происхожденье видов»,
Сморозишь про «естественный отбор»…

Боюсь, войдешь ты в школьную программу,
И станут детям вдалбливать фигню…
Обидно мне за Еву и Адама,
За Авеля и прочую родню!

Никто из наших не сидел на ветке,
И были все культурными вполне…»

«Дур-р-рак!» - тут крикнул попугай из клетки.
Не знаю точно: Чарльзу или мне.
Stanislaw
Я выполнил изучение гаплoтыпов 25 маркэровых гаплoгрупы A и субклядов, не очень отчетливо разделoныx.
Интересные результаты!
Наиболее старым предъявил себя род палестинца Abdel-Hadi (Абдэль-Гади), ZPQVF.

Каким путем?

Из всёx позаафрыканских гаплoгруп я выбрал наугад154 гаплoтыпы
и по очереди их сравнил с гаплoтыпoм ZPQVF
Весь GD усрeднил, и для таблицы FTM 67 маркэровoй перемножил через 2.75
Я получил GD112.75.
После вычета 5% для многоступенчатой мутации в одном действии,
я на таблице FTM получил его ТМRCA=124000 лет.
http://www.tropie.tarnow.opoka.org.pl/Table-FTM.pdf

Потом гаплoтып AbdelHadi я сравнил со всеми гаплoтыпами с гаплoгрупы А.
Я выбрал несколько наиболее высокиx GD, перевел, усрeднил и я получил GD=117 на 2.
Окончательный результат: ТМРCA=148000 лет!

Это в этот день cамый высокий результатрезультат для современного человека.

aklyosov
Уважаемый Stanislaw,

Давайте спокойно разберемся в двух вопросах: (1) зачем Вы это делали и что хотели получить, и (2) как Вы считали.

Вопрос 1.
Допустим, Вы считали правильно (что, видимо, не так, что мы увидим из п.2), допустим. Тогда Вы хотели получить время жизни общего предка гаплогруппы А и других гаплогрупп. Эта работа уже проведена в моей работе в Вестнике за май 2011, и уточнена в последующей работе с уважаемым И.Л. Рожанским. По малому набору гаплотипов гаплогруппы А я получил время жизни общего предка 136+/-9 тысяч лет назад, при расширении набора гаплотипов (с И.Л. Рожанским) мы получили 160 тысяч лет назад.

Вы получили 124 и 148 тысяч лет назад.

Ну, и что нового? Откуда такое ликование? Почему "Это в этот день cамый высокий результат для современного человека"?

Это же ведь уже опубликовано и обсуждено, еще в мае, полгода назад.

На самом деле это датировка альфа-гаплогруппы, от которой образовалась гаплогруппа А и отдельно все остальные гаплогруппы. То есть это - общий предок гаплогруппы А и всех остальных, которые НЕ произошли от гаплогруппы А.

Если Вы посмотрите в сводку ISOGG, то увидите, что гаплогруппа А произошла 60 тысяч лет назад. А Вы получили 124 и 148 тысяч лет назад. То есть это НЕ гаплогруппа А, не так ли? Ну, и чему Вы так радуетесь? Вам же это уже объяснили много раз.

Далее, альфа-гаплогруппа - это вовсе не обязательно "современный человек", на ней это не написано. У понятия "современный человек" другие критерии. Если у этой альфа-гаплогруппы будет другое строение челюсти и бочкообразная грудная клетка - это уже не "анатомически современный человек". Это - архаичный человек, архантроп. Или кто-нибудь еще, поскольку его никто не видел. Наконец, подобным путем можно и до времени шимпанзе дойти. Вы же не будете утверждать, что шимпанзе - это современный человек, только потому, что Вы рассчитали и экстраполировали.

Вам нужно понять, что такое "современный человек", а то так и будете путаться.

С этим разобрались. Ответ - Ваши расчеты ничего нового не дали, это все давно опубликовано, и то, что Вы нашли (или верите, что нашли) - это не гаплогруппа А, это общий предок гаплогруппы А и всех остальных гаплогрупп.

Вопрос 2.

Я не знаю, как Вы считали. У этого палестинца - гаплогруппа А. У меня - гаплогруппа R1a1. Между нами на 12 маркерах 14 мутаций, на 25 маркерах - еще 17 мутаций, всего 31 мутация. Всё, больше у него маркеров нет, только 25.

Так вот, 14 мутаций (между нами) на 12 маркерах дает 14/0.02 = 700 поколений, или с поправкой на возвратные мутации наш общий предок жил 20900 лет назад.

31 мутаций на 25 маркерах дает 31/0.046 = 674 поколений, или с поправкой на возвратные мутации наш общий предок жил 19250 лет назад.

Я не имею понятия, как у Вас могло получиться 124 или 148 тысяч лет. Проверьте Ваши расчеты.

В любом случае, как Вы понимаете, не мог общий предок гаплогруппы А и R1a1 жить 20 тысяч лет назад. Именно потому нельзя использовать эти панели маркеров для таких древних расчетов. Причина понятна - там набегает так много возвратных мутаций, что расчеты теряют смысл. Именно потому я калибровал сверхмедленную 22-маркерную панель маркеров, и это с ее помощью мы вышли на 136-160 тысяч лет назад.
Stanislaw
Следует читать,
рассмотреть и сравнить с тем, что написано здесь на форуме и в Вестнике (vol. 4, nr 7 i 10, 2011).

The Nubian Complex of Dhofar, Oman: An African Middle Stone Age Industry in Southern Arabia
(November 30, 2011):
http://www.plosone.org/article/info%3Adoi%...al.pone.0028239
Por. Dienekes,
http://dienekes.blogspot.com/2011/12/nubia...arabia-106.html
Цитата
”Abstract
Despite the numerous studies proposing early human population expansions from Africa into Arabia during the Late Pleistocene, no archaeological sites have yet been discovered in Arabia that resemble a specific African industry, which would indicate demographic exchange across the Red Sea. Here we report the discovery of a buried site and more than 100 new surface scatters in the Dhofar region of Oman belonging to a regionally-specific African lithic industry - the late Nubian Complex - known previously only from the northeast and Horn of Africa during Marine Isotope Stage 5, ~128,000 to 74,000 years ago. Two optically stimulated luminescence age estimates from the open-air site of Aybut Al Auwal in Oman place the Arabian Nubian Complex at ~106,000 years ago, providing archaeological evidence for the presence of a distinct northeast African Middle Stone Age technocomplex in southern Arabia sometime...
(...)
The taxonomic identity of the Nubian Complex toolmakers is unknown, as no skeletal evidence has been discovered in association with any such assemblage. Although some archaic forms may have persisted in other parts of Africa at that time [79], the distribution of early anatomically modern human (AMH) remains suggest this species is the most likely candidate to have occupied northeast Africa during the Late Pleistocene. Cranial fragments of Homo sapiens found in the Omo river valley, Ethiopia (Fig. 1), represent the first appearance of AMH in East Africa ~195 ka [80]. Remains from Herto [81], Singa [82], and Mumba [83] in East Africa date to between ~160 and ~100 ka. Skeletal remains from Jebel Irhoud in Morocco show that an early form of Homo sapiens had expanded into North Africa as early as ~160 ka [84], and a modern human child discovered at Grotte des Contrebandiers in Morocco verifies the presence of AMH in North Africa by ~110 ka [85]. At the site of Taramsa Hill 1 in the lower Nile Valley, an AMH child dated to ~55 ka was found in association with a lithic industry (Taramsan) that is thought to have developed out of the late Nubian Complex [21], [86]. Despite the lack of direct evidence, given that AMH are the only species to have been found in North Africa from the late Middle Pleistocene onward, it is warranted to speculate that the Nubian Complex toolmakers were modern humans.”


Вестник, 4/10 (1937-1938):
Цитата
”Судя по результатам настоящей работы, которые будут, конечно,
уточняться и дополняться, непрерывное развитие человека было, и иначе и
быть не могло – оно идет от самых первых гоминидов и ранее, но идет
разными «рукавами». Есть одна африканская линия, которая начинается со
времен сотни тысяч лет назад, и, конечно, не может в те времена
представлять «современного человека» по любой классификации. Ее
характерный признак – совершенно отличные величины DYS438, равные
14-16, в то время как у остальных людей планеты, неафриканцев, там
величины обычно (или исключительно) 8-11 (см. выше) ”

Ученые почти все генетические заболевания, а также способность переваривать лактозу
назначить один или несколько одноразовых команды и уникальные мутации
относья к одной или группы нескольких, одиночныx, и уникальныx мутации.

Между тем, yникальное творение и эволюция современного человечества можно было бы сделать самостоятельно и в "многиx рукаваx"? Возникновение современного человека это событие уникальное и единственное в повести земного земного шара, если не космоса. Наверное требовало новых единственных мутаций и огромного единственного импульса возникновения новых функций генов уже существующих.

Вестник (1968):
Цитата
”...В тот же период (64±6 тысяч
лет назад) от альфа-гаплогруппы отпочковалась бета-гаплогруппа. Они в
Африке не были, и антропология их была «Русской равнины», ”

Ну так, это мы уже знаем, в чем дело в этой теории.

Вестник (1928):
Цитата
”Действительно, анализ гаплотипов показал, что общий предок линии,
обозначенной выше как гаплогруппа А (первая строка) жил 85 тысяч лет
назад (Клёсов, 2011a,cool.gif, а общий предок двух последующих линий жил
примерно 266 тысяч лет назад (Клёсов и Рожанский, 2011, п.1499) или 160 тыс лет
назад (Klyosov and Rozhanskii, 2011, Advances in Anthropology, в печати). Его
современные потомки живут в Африке, в частности, на западе Камеруна.”

Я не знаю такой группы гаплoтыпoв, который MRCA жил раньше 120 тысяч лет.
Некоторое отдельное гаплoтыпы делали такое впечатление, что более старые чем, считал Cruciani. Но более точный анализ и несколько сот разных наборов с гаплoгрупы A, A и B, A и позаафрыканьских гаплoгруп показали (на выручку таблицы FTM – Full Time ot the Mutations) что никакой предок группы гаплoтыпов не превзошел 120 тысяч лет.
Один MRCA индивидуал лица (Abdel-Hadi) пришел немного над 120 тысячам.

ТMRCA гаплoтыпов гаплoгрупы A и B, то есть в общем также "отец" гаплoгруп А1а-Т и А1b (по ономастике Cruciani), равен 110 тысяч (точнее 109,600) лет.

В группе A были присутствующий тоже тот, которыx предок - по вашему счету - имел восходить к 266 тысяч летам.
Вы, уважаемый A.Клёсов, всегда критиковали - да и то сказать - это, что некоторый выберая и анализируют время отдельных медленных маркеров и на их основании подсчитывают TMRCA.
Гаплoтыпы надо относиться как целое!

Вестник (1929):
Цитата
”Африканские гаплогруппы А и В
эволюционировали независимо от неафриканских гаплогрупп. Когда на
самом деле образовались гаплогруппа А – мы не знаем, потому что многие
ее ветви (возможно, самые древние в том числе) определенно прошли
бутылочные горлышки популяции и их потомков нет среди нас, поэтому
гаплотипы недоступны”

К гаплoгрупe A (Адам) доходиться через сравнение А1а-Т и А1b.
Представителями гаплoгрупы A1а-Т мочь быть А1а, А2, А3, B, R и какая-либо позаафрыканьска.
Только три отдельное гаплoтыпы с гаплoгрупы B выдавали себя более старое чем 120 тысячи лет. Но предъявилоcь, что они имеют тоже ”null” мутации, что им дало фальшивыx 12 дополнительныx мутации в GD. Эto: 9GUQD, D98DU, H9D7T.

Вестник 4/7 (1499):
Цитата
”На этом понятии мы остановимся позже, а пока
отметим, что разница между двумя базовыми 6-маркерными (усеченными
22-маркерными гаплотипами) составляет 9.25 мутаций, что транслируется в
9.25/0.00167 = 5,539 а 15,720 поколений, или почти 400 тысяч лет между
общими предками этих подгрупп. Это дает возраст ИХ общего предка
(393,000+50,100+88,200)/2 = 266,000 лет...
...это не аберрация какого-то одного гаплотипа, а
достаточно воспроизводимая серия из нескольких гаплотипов разных баз
данных.”
. Вы можете подать эти особое гаплётыпы, если только стандартные, а не якес остаточное?
Эти поданное во Вестникe 4/7 (1497) знаюсь. Соответствуют с другими этой группы.

aklyosov
Уважаемый Stanislaw,

У нас получается бесконечное обсуждение, потому что Вы не отвечаете на вопросы предыдущих сообщений.

Я Вам задал два вопроса, повторяю:

Давайте спокойно разберемся в двух вопросах: (1) зачем Вы это делали и что хотели получить, и (2) как Вы считали.

Вопрос 1.

Допустим, Вы считали правильно (что, видимо, не так, что мы увидим из п.2), допустим... Вы получили 124 и 148 тысяч лет назад.

Ну, и что нового? Откуда такое ликование? Почему "Это в этот день cамый высокий результат для современного человека"?

Это же ведь уже опубликовано и обсуждено, еще в мае, полгода назад.


На это Вы не ответили.

Далее, вопрос 2.

Я не знаю, как Вы считали. У этого палестинца - гаплогруппа А. У меня - гаплогруппа R1a1. Между нами на 12 маркерах 14 мутаций, на 25 маркерах - еще 17 мутаций, всего 31 мутация. Всё, больше у него маркеров нет, только 25.

Так вот, 14 мутаций (между нами) на 12 маркерах дает 14/0.02 = 700 поколений, или с поправкой на возвратные мутации наш общий предок жил 20900 лет назад.

31 мутаций на 25 маркерах дает 31/0.046 = 674 поколений, или с поправкой на возвратные мутации наш общий предок жил 19250 лет назад.

Я не имею понятия, как у Вас могло получиться 124 или 148 тысяч лет. Проверьте Ваши расчеты.


Вы проверили? Ну, и что получилось? Но Вы тоже не ответили.

То есть каждый раз Вы что-то выхватываете, не понимая сути, я Вам подробно показываю, что Вы не поняли или дали неправильный ответ, Вы это проглатываете и идете дальше, опять что-то выхватывать.

Это - плохая "дискуссия".

Вот и сейчас - то же самое. Вы дали ОЧЕНЬ длинное переписывание, ну и что? Почему не дать просто своими словами, что нашли признаки человека в Аравии, с датировкой 106 тысяч лет назад. Это уже означает, что не мог "человек выйти из Африки 60-70 тысяч лет назад". Вы согласны? Вы вообще поняли, о чем в статье речь? Причем там нашли даже не кости, а "признаки", то есть стоянки.

Диенекес тоже пишет о том, что это расшатывает теорию "Выхода из Африки". Почему Вы его не цитируете? Откуда такое избирательное цитирование?

Цитата(Stanislaw @ 4.12.2011, 16:16) *
Ученые почти все генетические заболевания, а также способность переваривать лактозу
назначить один или несколько одноразовых команды и уникальные мутации
относья к одной или группы нескольких, одиночныx, и уникальныx мутации.


А это здесь причем? Повторяю вопрос - Вы что хотите этим сказать? Вы можете кратко выразить свою мысль?

Способность переваривать лактозу у разных популяций разная. Способность усваивать, скажем, морских моллюсков тоже разная. Ну и что?

Я Вам даю простой экспериментальный факт, что ни в Вас, ни во мне нет снипа М91, который есть у африканцев гаплогруппы А. То есть мы с Вами от них не произошли. Далее, то же самое, у нас нет снипов гаплогруппы В. То есть мы произошли и не от них. Вы согласны?

Я Вам говорю еще раз, что мы с африканцами идем разными рукавами во всяком случае последние 160 тысяч лет. Поэтому мы не могли произойти от них и выйти из Африки 60-70 тысяч лет назад. Вы согласны?

Вот когда ответите, будем продолжать. И, пожалуйста, ответьте на вопросы, заданные мной в предыдущем сообщении, о Ваших "расчетах".
Stanislaw
Цитата
Вопрос 1.
Допустим, Вы считали правильно (что, видимо, не так, что мы увидим из п.2), допустим...
Вы получили 124 и 148 тысяч лет назад.
Ну, и что нового? Откуда такое ликование?
Почему "Это в этот день cамый высокий результат для современного человека"?
Это же ведь уже опубликовано и обсуждено, еще в мае, полгода назад.
На это Вы не ответили.

Я на вопрос не ответил, потому что я не видел в нём научной материи.
Кроме того не зависело мне o ликование, о какое-то соперничество, кто первый... кто выше...
”Самый высокий результат” касался: "самый высокий среди гаплoтыпoв", а не: ”среди подсчитаныx авторами”.

Цитата
Далее, вопрос 2.
Вы получили 124 и 148 тысяч лет назад (...)
Я не знаю, как Вы считали. У этого палестинца - гаплогруппа А.
У меня - гаплогруппа R1a1. Между нами ... всего 31 мутация.
Всё, больше у него маркеров нет, только 25.
Так вот, 14 мутаций (между нами) на 12 маркерах дает 14/0.02 = 700 поколений, или с поправкой на возвратные мутации наш общий предок жил 20900 лет назад.
31 мутаций на 25 маркерах дает 31/0.046 = 674 поколений, или с поправкой на возвратные мутации наш общий предок жил 19250 лет назад.
Я не имею понятия, как у Вас могло получиться 124 или 148 тысяч лет.
Проверьте Ваши расчеты.

Я здесь сложу, что я не поддерживаю этой высоты лет MRCA для Abdel-Hadi.
Чтобы пересчитать его GD из 25 маркэровэго гаплoтыпу на таблицу 67 маркэровy, я употребил переводной коэффициент 2,75.
Oткуда его взял?
Я подсчитал его на основании этого, что умныйe написали:
http://archiver.rootsweb.ancestry.com/th/r...1-11/1321620525
Цитата
The first 25 markers contain 129 mutations, that is 129/26/0.046 = 108 generations
The first 37 markers contain 256 mutations, that is 256/26/0.090 = 109 generations
The first 67 markers contain 355 mutations, that is 355/26/0.120 = 114 generations
The first 111 markers contain 552 mutations, that is 552/26/0.198 = 107 generations

Я выполнил однако десятки, может сотни новых сравнений.
Новый коэффициент равен теперь 2.6 для 25 маркэровэго гаплoтыпa
и 1.6 для 37-маркэровэго гаплoтыпa.
Tеперь Abdel Hadi имеет к Dorsey, Jones и Evans GD=112.
Надо отнять 5% (6 мутаций) на счет многоступенчатых мутаций (в одном акте мэёсы) и разделить через два.
GD=53 это на таблицы полного времени мутации (full time ot the mutations, FTM) 118,200 лет.
http://www.tropie.tarnow.opoka.org.pl/Table-FTM.pdf
Ну, такая моя таблица (охватывает все, а не только часть возвратных мутаций).
...................................
Ваши 33 мутации в 25 маркэровым гаплoтыпе это в 67 маркэровым
33 x 2.6 = 86GD (-4) = 82 / 2 = 41.
Это 46.329 лет.
Такое капризы GD, а не таблиц!
aklyosov
Цитата(Stanislaw @ 5.12.2011, 9:16) *
Я на вопрос не ответил, потому что я не видел в нём научной материи.
Кроме того не зависело мне o ликование, о какое-то соперничество, кто первый... кто выше...


Ну как же? А это кто написал?

Цитата(Stanislaw @ 5.12.2011, 9:16) *
Это в этот день cамый высокий результат для современного человека


Научной материи здесь в самом деле нет, потому что Вы написали неправильно. Причем неправильно четырежды - и "в этот день", и "самый высокий результат", и "для современного человека", и что Вы не видели "кто выше". А написали - "самый высокий".

Потому я и ответил, что это уже давно известно, что это не "самый высокий", и вовсе не обязательно, что для "современного человека". Шимпанзе тоже наш предок, но это вряд ли "современный человек".

То есть это в некотором роде "научные материи".

Ну ладно, написали неправильно, и пусть. Не Вы один пишете неправильно.


Далее, я задал вопрос:

>Далее, вопрос 2.
[i]Вы получили 124 и 148 тысяч лет назад (...)
Я не знаю, как Вы считали. У этого палестинца - гаплогруппа А.
У меня - гаплогруппа R1a1. Между нами ... всего 31 мутация.
Всё, больше у него маркеров нет, только 25.
Так вот, 14 мутаций (между нами) на 12 маркерах дает 14/0.02 = 700 поколений, или с поправкой на возвратные мутации наш общий предок жил 20900 лет назад.
31 мутаций на 25 маркерах дает 31/0.046 = 674 поколений, или с поправкой на возвратные мутации наш общий предок жил 19250 лет назад.
Я не имею понятия, как у Вас могло получиться 124 или 148 тысяч лет.
Проверьте Ваши расчеты.



Так вот, то, как Вы считали, и сейчас описали - к сожалению, ВСЁ неправильно.

Давайте я объясню, если не Вам, так другим.

Повторяю мой пример другими словами.

Есть 25-маркерный гаплотип палестинца из гаплогруппы А.
Есть мой гаплотип из гаплогруппы R1a1.
Между нашими 25-маркерными гаплотипами 31 мутация.

31 мутация между двумя 25-маркерными гаплотипами дает расстояние между нами и нашим общим предков 19250 лет (расчет приведен выше). Если расчет непонятен, то 674 поколения --> 1540 поколений (с поправкой на возвратные мутации), то есть 38500 лет. Но это - удвоенное расстояние, его нужно разделить на 2. Получается 19250 лет. Этого быть просто не может, а не может быть потому, что по 25-маркерным (37- или 67-маркерным) гаплотипам считать такие расстояния нельзя. Нельзя в принципе. Потому что возвратные мутации там бегают как сумасшедшие по десять и больше раз между гаплотипами, и ломают всю картину.

Поэтому я и написал Вам, что так считать нельзя, и 140 тысяч лет так никогда не получится.

Но давайте я покажу, как Вы считали. Вы взяли 25-маркерный гаплотип палестинца и Dorsey, причем у палестинца был 25-маркерный гаплотип, а у Dorsey - 67-маркерный. Но Вы решили превратить 25-маркерный в 67-маркерный по мутациям, и взяли мои расчеты для другого случая (для выборки для гаплогруппы E-V13 было 129 мутаций для 25-маркерных гаплотипов и 335 мутаций для 67-маркерных). Ладно, пусть, хотя это уже большая натяжка. У Вас получилось, что число мутаций при переходе из 25-маркерного гаплотипа к 67-маркерному возрастает в 2.75 раз. Хотя на самом деле там 335/129 = 2.60. И Вы написали

Цитата(Stanislaw @ 5.12.2011, 9:16) *
Новый коэффициент равен теперь 2.6 для 25 маркэровэго гаплoтыпa


На самом деле правильнее было бы взять отношение 0.12/0.046 = 2.61, хотя в данном случае практически совпало (0.12 и 0.046 - это константы скорости мутации для 25- и 67-маркерных гаплотипов).

Так что он не "равен теперь", а давно такой был.

Ну ладно. Далее Вы умножили разницу в мутациях между 25-маркерными гаплотипами палестинца и Dorsey на 2.6, чтобы якобы получить разницу между их 67-маркерными гаплотипами. Вот так уже делать нельзя. И вместо 43 мутаций между их 25-маркерными гаплотипами Вы получили якобы 112 мутаций между их 67-маркерными гаплотипами.

Вопрос - а зачем это было нужно делать? Вас что, те 43 мутации не устраивали? А там бы получилось

43/0.046 = 935 --> 2870 поколений, то есть 71,750 лет между ними, то есть 35,900 лет до их общего предка.

То есть Вы не разделили на 2, а умножили на 2. И получили якобы 143 тысяч лет. Теперь Вы понимаете, что у Вас практически ВСЁ неправильно?

На самом деле Вы получили не 143 тысячи лет, а

Цитата(Stanislaw @ 5.12.2011, 9:16) *
Надо отнять 5% (6 мутаций) на счет многоступенчатых мутаций (в одном акте мэёсы) и разделить через два.
GD=53 это на таблицы полного времени мутации (full time ot the mutations, FTM) 118,200 лет.


53 мутации в 67-маркерном гаплотипе это 53/0.12 = 442 --> 756 поколений, то есть 18,900 лет. А не 118,200 лет. Ошибка в 625%.

Ну, и на десерт:

Цитата(Stanislaw @ 5.12.2011, 9:16) *
Ну, такая моя таблица (охватывает все, а не только часть возвратных мутаций).
...................................
Такое капризы GD, а не таблиц!


biggrin.gif

Это - не капризы мутаций. Это просто Ваше неумение считать. Это - поправимо, но надо захотеть. Вы пока не хотите.
aklyosov
Уважаемый Stanislaw,

Сказав "не хотите" я имел в виду то, что эти подходы у нас давно разработаны. Но вместо того, чтобы их использовать, Вы все время пытаетесь чего-то оспорить, начинаете изобретать велосипед, придумывать какие-то "коэффициенты", и в итоге у Вас получается хронически неправильно. Не надо спорить, надо использовать то, что уже готово.
Stanislaw
Цитата
Вы дали ОЧЕНЬ длинное переписывание, ну и что? Почему не дать просто своими словами, что нашли признаки человека в Аравии, с датировкой 106 тысяч лет назад.
Вы, уважаемый Анатолий, в русском языке более хорошие.
Ваше изложение совершенно правильное. Благодаря!

Цитата
Это уже означает, что не мог "человек выйти из Африки 60-70 тысяч лет назад". Вы согласны? Вы вообще поняли, о чем в статье речь? Причем там нашли даже не кости, а "признаки", то есть стоянки.

Я полное понять цитированных текстов оставил читателям.
Я дал ссылку к статьям.
Но не знаю, ли авторы написали немного, что "человек не мог выйти из Африки 60-70 тысяч лет назад".
Могло это быть „out of Afrika” - выйти из Африки, „out of Arabia” - выйти из Аравии...
Могли быть, и были (!) многочисленные выходы...

Цитата
Диенекес тоже пишет о том, что это расшатывает теорию "Выхода из Африки". Почему Вы его не цитируете? Откуда такое избирательное цитирование?

Диенекесс только пробует спорить.
Я не цитировал его, потому что вы написали ведь, что...уже ”ОЧЕНЬ длинное переписывание”
Но я дал ссылку к Dienekes.

Цитата(Stanislaw @ 4.12.2011, 16:16)
Ученые почти все генетические заболевания, а также способность переваривать лактозу
назначить один или несколько одноразовых команды и уникальные мутации
относья к одной или группы нескольких, одиночныx, и уникальныx мутации.

Цитата
А это здесь причем? Повторяю вопрос - Вы что хотите этим сказать? Вы можете кратко выразить свою мысль?

Ваше, цитированные ниже слова, показывают, что вы хорошо поняли в чем дело. Благодаря!

Цитата
Способность переваривать лактозу у разных популяций разная. Способность усваивать, скажем, морских моллюсков тоже разная. Ну и что?

Только различие межи переваривать лактозу или не - небольшoe.
А между быть человеком или не быть - огромное различие.

Цитата
Я Вам даю простой экспериментальный факт, что ни в Вас, ни во мне нет снипа М91, который есть у африканцев гаплогруппы А. То есть мы с Вами от них не произошли. Далее, то же самое, у нас нет снипов гаплогруппы В. То есть мы произошли и не от них. Вы согласны?
О снип М91 не огорчаемся преждевременно.
Генетики еще нет знают, где его поместить на дереве.
Тестировать в гаплoгрупе (в гаплoгрупах) A только начинаются (расходами дарителей, а не клиентов - такая действительность!).
Что обозначит: „мы с Вами от них (M91) не произошли”?
Так, но мы о чем спорим, ли об отдельных мутациях в гаплoгрупах, ли о гаплoгрупах и отцах гаплoгруп?
Мы напр. не родом от гаплoгрупы C и мутации М130, которая когда-то (ложно?) была сочтена отцом гаплoгрупы C. Hо мы родом из от P143, который назывался бы гаплoгрупа C, если бы так сначала признали. Потому что вправе к тому же.
И мы тогда были бы родом от гаплoгрупы C.
Все зависит от произвольной ономастики!

Мы аналогично могли бы произxoдить от гаплoгрупы I, если бы уже ее отцовскую мутацию М529 и пpa-отцовскую L15 назвали гаплoгрупом I. Потому что они вправе к тому же.
Аналогично от гаплoгрупы B, если бы уже ее отцовская мутация, V21 и т. д., наименовалась гаплoгрупа B, а не B-T.
Мы были бы родом из от гаплoгрупы (например) А3, если бы ее отцовская мутация V221 наименовалась гаплoгрупом А3. Потому что онa вправе к тому же.
И так далее.
Конечно я думаю, что эти C-Т, B-Т, А-Т должны получить прямые названия C, B, A, для которыx они отцовские.
Я слежу тоже, каждая из ветвей, выявленных Cruciani, в связи на старину отделиться, должнa быть отдельнa гаплoгрупa.

Цитата
Я Вам говорю еще раз, что мы с африканцами идем разными рукавами во всяком случае последние 160 тысяч лет. Поэтому мы не могли произойти от них и выйти из Африки 60-70 тысяч лет назад. Вы согласны?

Давайте подождем более далекие изучение. До сих пор показывают на одну генетическую семью анатомического современного человека (АМH) с хромосомным Адамом-отцом, примерно 120000 лет назад. Между А1-Т и А1b, мы видели, небольшое расстояние генетическое и временное.

Цитата
Вот когда ответите, будем продолжать. И, пожалуйста, ответьте на вопросы, заданные мной в предыдущем сообщении, о Ваших "расчетах".

Я не люблю в горячем виде соответствовать, потому что тогда возникает опасность спора. Как-то не грезится мне война... хотя бы частный польский-российский бой...
aklyosov
Цитата(Stanislaw @ 5.12.2011, 13:44) *
Цитата
Я Вам даю простой экспериментальный факт, что ни в Вас, ни во мне нет снипа М91, который есть у африканцев гаплогруппы А. То есть мы с Вами от них не произошли. Далее, то же самое, у нас нет снипов гаплогруппы В. То есть мы произошли и не от них. Вы согласны?
О снип М91 не огорчаемся преждевременно.
Генетики еще нет знают, где его поместить на дереве.
Тестировать в гаплoгрупе (в гаплoгрупах) A только начинаются (расходами дарителей, а не клиентов - такая действительность!).
Что обозначит: „мы с Вами от них (M91) не произошли”?
Так, но мы о чем спорим, ли об отдельных мутациях в гаплoгрупах, ли о гаплoгрупах и отцах гаплoгруп?
Мы напр. не родом от гаплoгрупы C и мутации М130, которая когда-то (ложно?) была сочтена отцом гаплoгрупы C. Hо мы родом из от P143, который назывался бы гаплoгрупа C, если бы так сначала признали. Потому что вправе к тому же.
И мы тогда были бы родом от гаплoгрупы C.
Все зависит от произвольной ономастики!


Это неверно.

Не имеет значения, где и что разместить на дереве. Дерево - это просто классификация. А SNP - это участок в ДНК, который ОБЯЗАН передаваться от отца к сыну. Не имеет значения, как его называть. В нас - миллионы снипов от шимпанзе, у который и названия нет. А они нам передались.

Так вот, снипы от шимпанзе передались, а снип под названием М91 от африканцев - не передался. Причем здесь ономастика?

Это означает, что у нас и африканцев гаплогруппы А - разные предки. Как бы мы эту гаплогруппу не называли, X, Y, или Z.

Цитата(Stanislaw @ 5.12.2011, 13:44) *
Давайте подождем более далекие изучение.


Так этот процесс бесконечен. Но наука строится на том, что УЖЕ известно. А Вы это пытаетесь опровергать. Вот в чем дело.

Как-то не грезится мне война... хотя бы частный польский-российский бой...

У нас не война. Вы просто (1) неправильно считаете, и (2) не признаете ДАННЫЕ.

Таких войн не бывает.
Igor1961
Вот еще один кирпичик в конструкцию, что, по идее, должна связать снипы Cruciani и Карафет.

Вот что буквально говорится в недавней статье T.M. Simms et al. Paternal Lineages Signal Distinct Genetic Contributions From British Loyalists and Continental Africans Among Different Bahamian Islands, Am. J. Phys. Anthopology, 146:594–608 (2011), любезно предоставленной администратором проекта гаплогруппы А.

Цитата
Two samples that fell outside of haplogroups B-T (defined by M42) were observed in Abaco (1.5%) and New Providence (0.7%), two Bahamian islands separated by a total of 139.4 km, as well as in a single sample from Haiti (unpublished data). When tested for V171, which, according to Cruciani et al. (2011a) defines the A2-T lineage, all three samples exhibited the ancestral allele. Instead, each individual was derived for the paralogous V152 mutation that determines the A1b lineage. It should be noted that each of the three samples possessed an eight base pair long Poly-T stretch at the M91 locus, indicative of the monophyletic haplogroup A defined by Karafet et al. (2008). However, as a result of the rearrangement of the tree by Cruciani et al. (2011a), haplogroup A no longer represents a monophyletic group, as the A2 and A3 lineages are now united with all haplogroup A lineages other than A1 by their shared possession of V171.


Кто-нибудь что-нибудь понял из этой чрезвычайно уклончивой фразы? Я так понял, что образцы с Багам и Гаити дали негативный тест на V171, что в схеме Кручиани задает линию A2-T, но положительный тест на V152 отнес их к параллельно гаплогруппе A1b. Все прекрасно и логично. Помимо того, у всех 3-х образцов подтвердился также снип М91, что по схеме Карафет относит их в гаплогруппу А. Тоже все логично.

Как мы знаем, тот же снип М91 был найден и у носителей субкладлов A1a и A3b2. Более того, в гаплогруппном проекте FTDNA есть обладатель М91, у которого минус по V151 (эквивалентен V152) и V171. То есть, М91 - более древний, чем упомянутые уже снипы серии V. Поскольку он не встречается вне носителей гаплогруппы А, то это прямое подтверждение очень ранней вилки. И тут начинаются выкрутасы. Вместо того, чтобы сказать это открытым текстом, авторы в последнем предложении выдают невнятную фразу о новой классификации, из которой непонятно, куда же надо помещать М91. Предпочли отмахнуться, как от назойливой мухи.

Дальше по ходу статьи приводится 17-маркерный гаплотип подтвержденного A1b с Багамских островов, который оказывается очень близок к группе из Камеруна с DYS392=14 и DYS438=14. С почти 100 % вероятностью можно сказать, что они - из этой древней гаплогруппы. На гаплогруппном проекте есть участник с 37-маркерным гаплотипом из той же ветви. Будем надеяться, что он сделает апгрейд в обозримом будущем, и это позволит точнее позиционировать этот субклад на дереве
aklyosov
Действительно, написано неким эзоповским языком.

Цитата(Igor1961 @ 5.12.2011, 20:42) *
Цитата
When tested for V171, which, according to Cruciani et al. (2011a) defines the A2-T lineage, all three samples exhibited the ancestral allele. Instead, each individual was derived for the paralogous V152 mutation that determines the A1b lineage.


Кто-нибудь что-нибудь понял из этой чрезвычайно уклончивой фразы?


Если написатть прямо, то эти три человека не имеют V171, который имеют все остальные, включая и нас с "европейскими" гаплогруппами, но имеют те древние V152, которые тянутся из древнейшей глубины, и которых у нас нет.

Либо те трое из альфа-гаплогруппы с давностью 160 тысяч лет назад (но тогда и мы все должны эти снипы иметь), либо еще древнее, какая-то параллельная линия, либо отпочковались от альфа-гаплогруппы и приобрели эти снипы уже после отпочкования. .

А уж как эту линию назвать - дело хозяйское. Мы от них не происходим. Их снипов у нас нет. А они и есть африканцы, самые кондовые.

Но интересна манера этих попгенетиков писать. Повторяю: When tested for V171...all three samples exhibited the ancestral allele. Это означает, что этих снипов у них нет.

А дальше начинается обычная акробатика, как и что назвать "гаплогруппой А", чтобы всем было хорошо. Думаю, в итоге они назовут гаплогруппой А либо альфа-гаплогруппу, либо уж сразу шимпанзе. Тогда всем станет хорошо.


Цитата(Igor1961 @ 5.12.2011, 20:42) *
Помимо того, у всех 3-х образцов подтвердился также снип М91, что по схеме Карафет относит их в гаплогруппу А. Тоже все логично.


А вот это мне здесь не очевидно. Вместо того, чтобы напрямую написать, что у них есть снип М91, там написано:

It should be noted that each of the three samples possessed an eight base pair long Poly-T stretch at the M91 locus

То есть в локусе М91 у них есть 8-ми нуклеотидный прогон тимина. Да даже это они толком не написали. Написали "8-нуклеотидный участок длинного поли-тимина". Так длинный полимерный участок, или только 8 нуклеотидов? Но штука в том, что М91, насколько я помню, это не повтор тимина 8 раз. Я попробовал влезть в геном и найти М91, но там черт ногу сломит. Может, кто знает? В списке ISOGG расшифровки М91 нет, в отличие от других.

kosmonomad
Цитата(aklyosov @ 6.12.2011, 17:56) *
Я попробовал влезть в геном и найти М91, но там черт ногу сломит. Может, кто знает? В списке ISOGG расшифровки М91 нет, в отличие от других.

У Томаса есть все
http://ymap.ftdna.com/cgi-bin/gb2/gbrowse/hs_chrY/
вот здесь М91
http://ymap.ftdna.com/cgi-bin/gb2/gbrowse_...ymap%3Adatabase
Igor1961
Цитата(aklyosov @ 6.12.2011, 22:56) *
То есть в локусе М91 у них есть 8-ми нуклеотидный прогон тимина. Да даже это они толком не написали. Написали "8-нуклеотидный участок длинного поли-тимина". Так длинный полимерный участок, или только 8 нуклеотидов? Но штука в том, что М91, насколько я помню, это не повтор тимина 8 раз. Я попробовал влезть в геном и найти М91, но там черт ногу сломит. Может, кто знает? В списке ISOGG расшифровки М91 нет, в отличие от других.


Цитата(kosmonomad @ 6.12.2011, 23:07) *
Цитата(aklyosov @ 6.12.2011, 17:56) *
Я попробовал влезть в геном и найти М91, но там черт ногу сломит. Может, кто знает? В списке ISOGG расшифровки М91 нет, в отличие от других.

У Томаса есть все
http://ymap.ftdna.com/cgi-bin/gb2/gbrowse/hs_chrY/
вот здесь М91
http://ymap.ftdna.com/cgi-bin/gb2/gbrowse_...ymap%3Adatabase

Вадим, спасибо за ссылку. Вот описание снипа М91

Цитата
Name: M91
Type: snp
Description:
Source: M
Position: ChrY:20366926..20366926 (+ strand)
Length: 1
ISOGG_haplogroup: A
Mutation: 9T to 8T
YCC_haplogroup: A
allele_anc: ins
allele_der: del
comments: B9.87a
count_derived: 28
count_tested: 318
primer_f: GAGCTTGGACTTTAGGACGG
primer_r: AAACTTTAAGGCACTTCTGGC
primary_id: 44797
gbrowse_dbid: ymap:database

То есть, это индель-мутация, что в гаплогруппе А проявляется как прогон 8-ми тиминов, как и написано в статье.

Однако, возникает странная ситуация. В проектах FTDNA встречаются такие комбинации снипов (курсивом отмечены те, что предполагаются из анализа STR):
M91+, P97+, P108+, V151-, V168-, V171-(N38376) - A1*
M91+, P97+, P108+, V151+, V171- (N71150) - A1b
M91+, P97+, P108+, V168+, V171+ (180250) - A1a
M91+, P97+, P108-, V151-, V171+, , V221+, V50+ (181787) - A2
M91-, P97-, Р108-, V168+, V221+ (152884) - R1a1a1

Как состыковать наличие снипов V168 и V211 как у носителей M91/P97, так и у тех, у кого эти снипы отстутствуют? Если считать V168 и V211 общими для всех современных людей, то что делать с носителями A1* и A1b, у которых там минус? Получается, возможны любые комбинации M91 и V168, кроме обоих минусов, так что иерархия летит кувырком. Кто-нибудь пробовал в этом разобраться?
Igor1961
Вот данные по снипу P97
Цитата
Name: P97
Type: snp
Description:
Source: PS
Position: ChrY:13395667..13395667 (+ strand)
Length: 1
ISOGG_haplogroup: BT
Mutation: G to T
YCC_haplogroup: BT
allele_anc: G
allele_der: T
comments: DFFRY AluY50 Chimp has G in this position but most humans T
count_derived: 587
count_tested: 591
primer_f: TGGAGGGTAAGTGAGTAG
primer_r: TTTTAATGGAACACCGTAG
primary_id: 43011
gbrowse_dbid: ymap:database


У участников WTA из гаплогруппы R1a1, как, скорее всего, и у всех остальных, кроме представителя A3b2 из Саудовской Аравии, в снипе М91 отмечено ins (т.е. 9Т в ряд), в снипе Р97 - Т. У всех ранее тестированных представителей гаплогруппы А там del (8T) и G.

Поскольку знак плюс или минус для снипа - это дело соглашения, то ничто не мешает присвоить положительные (т.е. мутировавшие от предка) значения М91-ins и Р97-Т. Тогда для гаплогруппы А они будут отрицательными, а для ВТ - положительными. Иными словами, они оказываются эквивалентными ранее определенным Р42 и SRY10831.1, что маркируют гаплогруппы ВТ.

Тем самым снимается противоречие из предыдущего сообщения, и при таком "переформатировании" мы наблюдаем следующую лесенку из представителей проектов FTDNA:

P108-, V151-, V168-, V171-, M91-, P97- (N38376) - A1*
P108-, V151+, V171-, M91-, P97- (N71150) - A1b
P108-, V168+, V171+, M91-, P97- (180250) - A1a
P108+, V151-, V171+, V221+, V50+, M91-, P97- (181787) - A2
.
.
.
Р108+, V168+, V221+, M91+, P97+ (152884) - R1a1a1

В этой схеме точно такая же смена знака проделана со снипом Р108 (T->C в позиции 13935642), что задает гаплогруппу А1. Снипы, сменившие знак, отмечены цветом. То есть, там действительно идет лесенка с той же самой шкалой времен, что была определена ранее. Предок "альфа"-гаплогруппы (в этой схеме она соответствует А1) как жил 160 тыс. лет назад или раньше, так и остается, но положение вилки между А и ВТ нужно уточнять.
Igor1961
Обратите внимание на верхнюю ступеньку в этой лестнице, которую занимает афроамериканец N38376 с минусом ПО ВСЕМ снипам, что у него исследовались. В схеме Cruciani эта ступенька отсутствует, там дерево укореняется по снипам V151 (et al) и V171 (et al.), и в его списке нет гаплотипов, где бы эти оба снипа были отрицательны. То есть, в коммерческой базе данных обнаружился представитель еще более древней ветви, чем те, о которых сообщалось в недавней статье Cruciani.

Насколько я знаю из переписки с администратором проекта гаплогруппы А, М. Хаммер и Т. Карафет уже в курсе об этой находке, а N38376 планируют исследовать в программе WTY, как только найдут спонсора. Надо сказать, что носитель этого гаплотипа не одинок - по STR к нему примыкают, по моим данным, еще 9 гаплотипов длиной 25 и более маркеров из США (4), Ганы (2), Ямайки, Колумбии и Панамы. Их общий предок приходится примерно на 4 тыс. лет назад. Значит, предками современных жителей Нового Света из этого списка были выходцы из разных этнических групп Западной Африки, а не кто-то один или группа близких родственников. В противном случае, мы бы имели всего несколько сот лет назад вглубь.

Помимо этой явно древней ветви, еще предстоит позиционитовать камерунцев с DYS438=16, по которым пока лишь известно, что они не из "бета"-гаплогруппы. Там тоже не исключены сюрпризы.
Stanislaw
Цитата(Igor1961 @ 7.12.2011, 7:19) *
Обратите внимание на верхнюю ступеньку в этой лестнице, которую занимает афроамериканец N38376 с минусом ПО ВСЕМ снипам, что у него исследовались. В схеме Cruciani эта ступенька отсутствует, там дерево укореняется по снипам V151 (et al) и V171 (et al.), и в его списке нет гаплотипов, где бы эти оба снипа были отрицательны. То есть, в коммерческой базе данных обнаружился представитель еще более древней ветви, чем те, о которых сообщалось в недавней статье Cruciani.

Насколько я знаю из переписки с администратором проекта гаплогруппы А, М. Хаммер и Т. Карафет уже в курсе об этой находке, а N38376 планируют исследовать в программе WTY, как только найдут спонсора. Надо сказать, что носитель этого гаплотипа не одинок - по STR к нему примыкают, по моим данным, еще 9 гаплотипов длиной 25 и более маркеров из США (4), Ганы (2), Ямайки, Колумбии и Панамы. Их общий предок приходится примерно на 4 тыс. лет назад. Значит, предками современных жителей Нового Света из этого списка были выходцы из разных этнических групп Западной Африки, а не кто-то один или группа близких родственников. В противном случае, мы бы имели всего несколько сот лет назад вглубь.

Помимо этой явно древней ветви, еще предстоит позиционитовать камерунцев с DYS438=16, по которым пока лишь известно, что они не из "бета"-гаплогруппы. Там тоже не исключены сюрпризы.

Уважаемый Игорь, я выражаю признание и большое спасибо за точное и прозрачное познакомление проблемы гаплoгрупы А.
Как видно, все впереди!



aklyosov
Цитата(Stanislaw @ 7.12.2011, 10:23) *
Уважаемый Игорь, я выражаю признание и большое спасибо за точное и прозрачное познакомление проблемы гаплoгрупы А.


Ну наконец-то уважаемый Stanislaw понял, что мы не вышли из Африки. И что мы не произошли из гаплогруппы А. И что с самой гаплогруппой А раздрай, и что ни Крусиани, ни Карафет, ни Кран пока не знают, как свести концы с концами в гаплогруппе А.

Думаю, уважаемый Stanislaw, Вам стоит взять пример с Вашего коллеги Larry Mayka, который понял, что ошибался, и публично об этом объявил. И это делает ему честь.

А история была проста. Я поместил на форуме RootsWeb расчеты по субкладу E-V13, которые показали, что общий предок жил примерно 3500 лет назад. Larry возразил, что он провел расчеты по программе Nordtvedt и получил между 6000 и 9000 лет, что сходится c возрастом ископаемого E-V13 (7000 лет).

Я прокомментировал, что "квадратичная" программа Nordtvedt должна завышать результаты счета, назвал расчет Larry "абсурдом" и предложил пересчитать. Позавчера Larry объявил, что, действительно, программа Nordtvedt сильно завышает данные, поскольку считает все подряд - и recLOH, и нулевые мутации, и мультикопийные маркеры - все принимая за нормальные мутации. Larry пересчитал и получил 3400 лет до общего предка субклада E-V13. После этого он принес публичные извинения, и сообщил, что мои расчеты полностью подтвердились.

Понимаете, уважаемый Stanislaw, как работают Ваши старшие коллеги? Вот это и есть научная честность.
Igor1961
Цитата(aklyosov @ 8.12.2011, 7:17) *
И что с самой гаплогруппой А раздрай, и что ни Крусиани, ни Карафет, ни Кран пока не знают, как свести концы с концами в гаплогруппе А.

Концы с концами сходятся, причем очень изящно, если принять в качестве предковых значений G для Р97, del для М91 и C для Р108. По обычному в SNP-филогении соглашению, предковый нуклеотид соответствует знаку минус в таблице снипов, и, значит, у всех представителей ВТ (Р97-Т, М91-ins, Р108-Т) там будут плюсы. То есть не у нас нет африканских снипов, а у африканцев нет наших. При такой трактовке схемы Cruciani и Карафет складываются в одно целое, как это показано в примере выше.

По этой схеме, снипы М91 и Р97 оказываются эквивалентами Р42 и SRY10831.1. Чтобы экспериментально опровергнуть такое отнесение, нужно найти гаплотипы, что дают 3 комбинации из 4-х возможных: М91+/Р42+, М91-/Р42-, М91+/Р42- и М91-/Р42+. Если систематически получаются лишь 2 из них, то снипы эквивалентны, и схема с предковой гаплогруппой А1 верна по состоянию на сегодняшний день.
aklyosov
Цитата(Igor1961 @ 7.12.2011, 18:19) *
По этой схеме, снипы М91 и Р97 оказываются эквивалентами Р42 и SRY10831.1


Что-то я не улавливаю. Р42 это вообще снип субклада D2a1a. SRY10831 долгое время назад активно обсуждался и мусолился со всех сторон. У африканцев его нет, а у нас он есть. Какая же здесь эквивалентность? У гаплогруппы А есть М91, а у нас ее нет. Какая же здесь эквивалентность?

Подробно обсуждалось, что SRY10831 есть у приматов, а в гаплогруппе А он отсутствует. Пришли к выводу, что он повторился два раза, но в обратную сторону, и опять выскочил в гаплогруппе R1al, но не в R1b. Какая же здесь эквивалентность с М91?
Igor1961
Цитата(aklyosov @ 8.12.2011, 9:06) *
Цитата(Igor1961 @ 7.12.2011, 18:19) *
По этой схеме, снипы М91 и Р97 оказываются эквивалентами Р42 и SRY10831.1


Что-то я не улавливаю. Р42 это вообще снип субклада D2a1a. SRY10831 долгое время назад активно обсуждался и мусолился со всех сторон. У африканцев его нет, а у нас он есть. Какая же здесь эквивалентность? У гаплогруппы А есть М91, а у нас ее нет. Какая же здесь эквивалентность?

Прошу прощения, снип гаплогруппы ВТ писал по памяти, перепутал буквы. Имел а виду М42, что отрицателен у всех носителей гаплогруппы А.

По поводу эквивалентности снипов, вот какие ПЕРВИЧНЫЕ результаты тестирования мы имеем для участников проектов гаплогруппы А и WTY-R1a1:

SNP________Hg A___WTY-R1a1
M42_________A______T
SRY10831____T______T
M91_______8T(del)_9T(ins)
P97_________G______T


Со снипом SRY10831 ситуация известная, гаплогруппу ВТ маркирует С в этой позиции, просто сейчас нет на руках первичных данных. Эквивалентность М91 и Р97, кажется, подтверждаиется на всех известных на сегодняшний день примерах. Значит, задача по доказательству неэквивалентности снипов М91/Р97 и М42/SRY10831.1 сводится к поиску гаплотипов, у которых А в М42 сочетается с девяткой Т (ins) в М91 и/или Т в Р97.

Иными словами, по текущей классификации такие гаплотипы не дожны относиться ни к гаплогруппе А, ни к ВТ. Если таковых нет, то Р97, М91, М42 и SRY10831.1 следует считать неразличимыми по своему положению на древе гаплогрупп. Насколько мне известно, таких гаплотипов пока не найдено. Среди людей, во всяком случае. По результатам тестирования носителей гаплогруппы А, снипы М91 (del) и Р97 (G) подтверждаются даже для самых далеко отстоящих гаплотипов, что дают разбег на сотни тысяч лет и различаются по снипам V серии. Специально пишу сам нуклеотид, чтобы не сбивать с толку плюсами и минусами, которые суть результат соглашения.

Собственно, из этого анализа я и сделал вывод, что в текущей версии ISOGG гаплогруппа А соответствует М91-/Р97-, а ВТ, соответственно, М91+/Р97+, если подходить строго к конвенции, что считать плюсом, а что минусом. В пользу такого отнесения говорит и ремарка Томаса к снипу Р97:"Chimp has G in this position but most humans T." Мost humans - это представители "бета"-гаплогруппы.

Аналогичными соображениями руководствовался и при смене знака у снипа Р108, что также задал головоломку для ISOGG. Если так не сделать, то пазл упорно отказывается собираться. Отсюда получается, что "альфа"-гаплогруппа и А1 (Р108 Т) в той лесенке, что привел выше - это одно и то же. Все остальные линии - производные от нее. По состоянию на сегодняшний день, во всяком случае.

P.S. Чтобы не бегать от поста к посту, повторяю лесенку субкладов А, как она видится с учетом этого анализа:

P108-, V151-, V168-, V171-, M91-, P97- (N38376) - A1*
P108-, V151+, V171-, M91-, P97- (N71150) - A1b
P108-, V168+, V171+, M91-, P97- (180250) - A1a
P108+, V151-, V171+, V221+, V50+, M91-, P97- (181787) - A2
!
!
Р108+, V168+, V221+, M91+, P97+ (152884) - R1a1a1

В скобках указаны номера китов с проекта гаплогруппы А. При анализе гаплотипа N71150 были привлечены данные из статьи о Багамских островах, где в качестве доказанного A1b был приведен очень близкий 17-маркерных гаплотип. В качестве представителя всего остального человечества высупил наш kosmonomad, за что ему большая благодарность.
aklyosov
Цитата(Igor1961 @ 7.12.2011, 20:50) *
Отсюда получается, что "альфа"-гаплогруппа и А1 в той лесенке, что привел выше - это одно и то же. Все остальные линии - производные от нее. По состоянию на сегодняшний день, во всяком случае.


Вот против этого никаких возражений нет. Или, по крайней мере, это пока ничему не противоречит. Они, правда, могут уйти еще глубже по времени, чем альфа-гаплогруппа, но мы этого пока не знаем.

Тогда получается, что примерно 160 тысяч лет назад (возможно, окажется и раньше) где-то обитала альфа-гаплогруппа. Где - мы не знаем. От нее отпочковалась гаплогруппа А (с выжившим снипом М91), и в итоге ушла в Африку, где сейчас и находится. Мы - не их предки. Потом отпочковалась бета-гаплогруппа, от которой и произошли, в частности, европеоиды, но дистанция в 100 тысяч лет между альфа- и бета-гаплогруппой наводит на мысль, что что-то там было, но пропало. 60 тысяч лет назад было некое бутылочное горлышко, из которого наши предки вышли уже вполне развитыми современными людьми. Думаю, что они были и до того, но почти все сгинули в результате чего-то катастрофического.

Потому мы - не потомки гаплогруппы А и не имеем их снипов, а у них, естественно, нет наших снипов.

Тогда все байки, что мы вышли из Африки потому что там "наибольшее разнообразие" там и остаются байками. Разнообразие там по двум основным причинам. Первая - то, что африканцы действительно древнее, их гаплогруппа А сидит в Африке от 80 до 120 тысяч лет, а мы, совершенно отдельная ветвь, вышли из бутылочного горлышка всего 64 тысячи лет назад. Естественно, у нас разнообразие меньше. Но не потому, что он африканцев произошли, а потому, что они, африканцы - старший брат. А братья один из другого не происходят.

Вторая причина разнообразия в Африке - это то, что там смешались гаплогруппы А и В. Они отстоят друг от друга совершенно далеко, потому что А - от альфа-гаплогруппы, а В - от бета-гаплогруппы. И когда они смешались, то "разнообразие" резко увеличилось. А попгенетикам все равно, что измерять. Они берут А и В, и говорят - ууу, какое разнообразие.

Поэтому аргумент "разнообразия" здесь - это профанация. Оно не определяет кто от кого произошел.

То же самое - любимый аргумент попгенетиков, что "при удалении от Африки разнообразие падает". Естественно, падает, в какую сторону ни пойти. Но падает не потому, что в Африке прародина, а потому, что там смесь А и В. Перешла R1a в Сибирь - вот и дистанция от Африки большая, и разнообразие (R1a) малое, но не потому, что R1a из Африки вышла, а потому что гаплогруппа молодая.

Все эти фантазии попгенетиков на уровне детского сада. Типа "если Х меньше чем Y, значит Х произошло от Y".

"Если шахматисты меньше баскетболистов, то шахматисты от баскетболистов произошли".
Igor1961
Цитата(aklyosov @ 8.12.2011, 11:17) *
Тогда получается, что примерно 160 тысяч лет назад (возможно, окажется и раньше) где-то обитала альфа-гаплогруппа. Где - мы не знаем. От нее отпочковалась гаплогруппа А (с выжившим снипом М91), и в итоге ушла в Африку, где сейчас и находится.

Строго говоря, гаплогруппа А в той формулировке, что сейчас принята, отсутствует в обновленной схеме, как таковая. Есть чрезвычайно далеко отстоящие друг от друга А2, А3, возможно, еще какие-то, и в их ряду "бета"-гаплогруппа. Так что об "отпочковании" речь пока не идет.

Снип М91 определяет гаплоруппу очень широко, как все те линии, что несут 8 тиминов подряд в позиции 20366926. А несут эту комбинацию все те, у кого также имеется аденин в М42 и гуанин в Р97. Все 3 снипа находятся в одной связке, что привязана ВТ. По сути, гаплогруппа А определена "от противного", как не ВТ. Женщин тоже можно определить как всех тех, кто не относится к мужчинам. По сути верно, если не вдаваться в тонкие детали, но информативно ли?
BeLah
по снипу М91:
у шимпанзе---9Т
у африканцев ---8Т
у неафриканцев(ВТ)---9Т

Кручиани предположил,что здесь было две мутации:
1) переход 9Т>8T от шимпанзе к африканцам
2) обратная мутация 8Т>9T от африканцев к BT

Чтобы подтвердить это предположение,он исключил М91,ввел новые снипы серии V и построил новое дерево,по которому:

ВТ потомок А2-Т
А2-Т потомок А1-Т
А1-Т потомок альфы

и никаких противоречий.
Stanislaw
WTY N38376: L898! (от Bonnie)
Igor1961
Цитата(Stanislaw @ 8.12.2011, 20:25) *
WTY N38376: L898! (от Bonie)

Because something is happening here
But you don’t know what it is
Do you, Mister Jones?

Боб Дилан "Ballad Of A Thin Man" smile.gif
Igor1961
Цитата(BeLah @ 8.12.2011, 18:26) *
по снипу М91:
у шимпанзе---9Т
у африканцев ---8Т
у неафриканцев(ВТ)---9Т

Кручиани предположил,что здесь было две мутации:
1) переход 9Т>8T от шимпанзе к африканцам
2) обратная мутация 8Т>9T от африканцев к BT

Чтобы подтвердить это предположение,он исключил М91,ввел новые снипы серии V и построил новое дерево,по которому:

ВТ потомок А2-Т
А2-Т потомок А1-Т
А1-Т потомок альфы

и никаких противоречий.

Ничего исключать не надо, потому что схемы Кручиани и Карафет прекрасно накладываются одна на другую, как можно видеть из таблички ключевых снипов.



Строки, отмеченные как A1b, A1a, A2 и A3, содержат данные из статьи Cruciani, численные символы соответствуют номерам китов с гаплогруппного проекта FTDNA, Bahamas - это снипы гаплотипа с Багамских островов из статьи Simms et al., почти в точности совпадающего с N71150 из проекта. В качестве образца для сравнения приведены данные по тем же снипам участников проекта WTY из гаплогруппы R1a1, любезно предоставленные уважаемым Боромиром.

Эта схема складывается при условии, что снипы М91, Р97 и М42 эквивалентны. В любом другом варианте идут нестыковки. Пока еще мало точек соприкосновения между обеими схемами в "субкладах" А2 и А3, но в целом взаимное расположение ветвей восстанавливается неплохо. На драфте Томаса Крана выложена та же самая схема ветвления (А2, А3 и ВТ веером от А1), но сделано это несколько невнятно, легко запутаться. Судя по наличию гаплотипа N38376 с родственниками, не укладывающимися в схему с А1а и A1b, одними этими ветвями дело не ограничивается.

Гаплотипы, приведенные в таблице, расходятся друг с другом на колоссальное количество мутаций даже в сверхмедленных форматах, причем без намека на группирование. Подсчет "в лоб" дает уже упоминавшиеся 160 тыс. лет до их общего предка. Сколько на деле, покажут расчеты по длинным гаплотипам, когда будут сделаны соответствующие апгрейды.
Stanislaw
Цитата(Igor1961 @ 8.12.2011, 19:05) *
На драфте Томаса Крана выложена та же самая схема ветвления (А2, А3 и ВТ веером от А1), но сделано это несколько невнятно, легко запутаться.
Судя по наличию гаплотипа N38376 с родственниками, не укладывающимися в схему с А1а и A1b, одними этими ветвями дело не ограничивается.

Bначале дискуссии уже я писал , что еще нет снипа хромосомного Адама, который прошел бы на всеx потомков, а чтобы его нет у Шимпанзе.
Еще его не открыли.
У Cruciani - Root пустой, без снипа!
Работы с снипами еще много. Во всей вертикали гаплoгрупы R примерно 100 снипов: 100 SNP на 25 тысяч лета.
Итак сколько снипoв должнo быть в нескольких знать вертикалях гаплoгрупы A на примерно 100-120 тысяч лет?

Igor1961
Цитата(Stanislaw @ 9.12.2011, 2:35) *
Bначале дискуссии уже я писал , что еще нет снипа хромосомного Адама, который прошел бы на всеx потомков, а чтобы его нет у Шимпанзе.

Если Вы внимательно рассмотрите таблицу подтвержденных снипов из предыдущего сообщения, то нет и снипа гаплогруппы А. Ее отнесение по М91-del и Р97-G сделано "от противного", примерно как античные греки считали определяющим признаком варваров отсутствие у них признаков эллинов.

Самый "глубокий" из известных сейчас снипов, это, видимо, Р108, что разделяет древнейшие линии (А1 в текущей нотации) и все остальные. Взаимное расположение ветвей с Р108-С и время до их общего предка, строго говоря, оценить очень сложно из-за скудости данных и колоссального разброса в мутациях. "Субклады" А1а и A1b на схемах Кручиани и Крана - это наверняка лишь небольшой фрагмент более сложного древа. В опубликованные деревья не попадают несколько УЖЕ известных, но недостаточно охарактеризованных линий. Слово "субклады" даю в кавычках, потому что по иерархии их правильнее называть макро-гаплогруппами.
Igor1961
Рассмотрим текущую ситуацию со снипами М91 и Р97 подробнее. Для этого доствточно рассмотреть снипы P108/V221 (эквивалентные для данного набора) и М91/Р97 (также эквивалентная пара).

Экспериментально подтверждены следующие их комбинации:

____________P108 / V221____M91 / P97
A1*/A1a/A1b____C / G________8T / G
A2/A3__________A / T________8T / G
BT_____________A / T________9T / T

Каких-то других вариантов пока не найдено, насколько мне известно. Наша задача - опознать, какая из этих четверок содержит предковые значения снипов, а какие - производные от нее. По законам комбинаторики их всего 3:

Вариант 1. ВТ --> A2/A3 --> A1*/A1a/A1b
Вариант 2. ВТ <-- A2/A3 --> A1*/A1a/A1b
Вариант 3. ВТ <-- A2/A3 <-- A1*/A1a/A1b

Первый из них соответствует дереву ISOGG-2010, в котором в качестве предковых снипов для М91 и Р97 записаны 9Т и Т, соответственно. Третий - это дерево Cruciani-2011, где те же снипы в ВТ оказываются производными. Второй - это примерно то, что получается в расчетах пана Станислава с далеко отстоящим от остальных субкладом А3. В нем, как и в третьем варианте, М91/Р97 в "бета"-гаплогруппе производные от предковых 8T / G.

Как выбрать наиболее вероятную последовательность? Если не привлекать дополнительную инфоримацию, они абсолютно равноправны. За неимением прямых данных по ископаемой ДНК, следует, очевидно, рассмотреть, каким временем датируются предки этих генеалогических линий. Для сводной гаплогруппы ВТ это порядка 60 тыс. лет назад, для А2/А3, к сожалению, недостаточно данных для такой оценки, а предок A1*/A1a/A1b убегает в глубокую древность - не менее 150 тыс. лет назад по пока еще фрагментарным данным. Достаточно взглянуть на первые 6 маркеров 22-маркерных сверхмедленных панелей у их носителей:

12 12 11 -- 10 11 -- 11 Ghana
12 13 10 -- 10 11 -- 10 USA (black)
12 12 14 -- 11 12 -- 14 Cameroon
12 10 11 -- 7 13 -- 8 Guinea-Bissau
13 11 12 -- 10 11 -- 16 Cameroon

Если представить дерево гаплогрупп в виде матрешки, где "дочки" вкладываются внутрь, то более обоснованным смотрится 3-й вариант с предковыми 8Т/G для снипов М91/Р97. С другой стороны, мы пока слишком мало знаем о ветвях А2 и А3, чтобы заведомо исключить из рассмотрения 2-й вариант.

Наконец, явно реликтовый характер ветвей А1 вполне сочетается с предположением, что в лице этих представителей Западной Африки мы встречаем осколок какой-то очень древней популяции, исчезнувшей повсюду, кроме этих мест, котрые по своим природным ландшфтам можно считать реликтом доледниковой эры. По данным палеоботаники, зона лесов там никогда не исчезала, даже во времена ледниковых максимумов. Родился общий предок этих людей в районе Гвинейского залива или совсем в другом месте, мы не знаем. Во всяком случае, костных останков такого возраста там пока не находили, так что мы даже не знаем, была ли это популяция анатомически современных людей или они относились к какой-то другой ветви..
Right & Midfield
Цитата(BeLah @ 8.12.2011, 13:26) *
Кручиани предположил,что здесь было две мутации:
- переход 9Т>8T от шимпанзе к африканцам
- обратная мутация 8Т>9T от африканцев к BT
Чтобы подтвердить это предположение,он исключил М91,
ввел новые снипы серии V и построил новое дерево

1. На наш взгляд - Fulvio Cruciani попытался изящно "притянуть за уши" группу BT к группе A.
Для этого он "предположил" про SNP то, что Вы показали,
и вдогонку - удревнил обе гаплогруппы так, чтобы они "уехали" за точку катастрофы Тоба.
Ибо ему так легче получается объяснить, что "всё из атомов" и "все мы из Африки".

Однако, мы считаем, что периодически происходящие катастрофы, при которых всё живое проходит сквозь "игольное ушко" - приводят к тому, что живое выживает локально, т.е. в убежищах. Общий первопредок мог быть откуда угодно, хоть из единого континента Гондваны,
но группы людей, выжившие в разных убежищах - не обязательно являются предками/потомками друг друга. Fulvio Cruciani это тоже прекрасно понимает, но пытается навязать нам иное:
группа BT - потомок группы A.

2. Для этого он сознательно вводит в формулы расчётов MRCA - значительно завышенный коэффициент возраста поколения - 30 лет. Это допустимо лишь для последнего времени, да и то - не для всего человечества, а только для стран "большой восьмёрки" ... "большой двадцатки". И совершенно недопустимо для периода 40-140 тлн, когда люди жили значительно меньше, оставляли потомство значительно раньше. Возможно, что возраст поколения в те времена - был 20 лет, или даже ещё меньше.

Но если группы BT и A значительно моложе, чем у Fulvio Cruciani, то они совершенно точно пережидали катастрофу Тоба - в разных географических убежищах! И это сильно мешает Fulvio Cruciani - связать их между собой отношениями "предок-потомок", ведь гораздо логичнее предположить отношения "два брата от одного предка". Кстати, в женской части ДНК-генеалогии - картина сходная: группы MN тоже non-african, т.е. можно полагать, что женские группы MN пережидали катастрофу Тоба вместе с мужскими группами BT. Сходная картина и в Африке: есть одна отдельно стоящая женская группа L0 (аналог мужской A0), есть несколько групп L1-L6 (аналог мужских A1-A3), и есть точно такая же проблема "присаживания" non-african групп MN - к африканскому дереву (аналогия ситуации с мужской BT).

3. То что Fulvio Cruciani вытворяет с деревом SNP - наводит на мысль, что он очень боится некой обратной гипотезы, а именно:
SNP M91 - сквозной от шимпанзе к группе BT. Эта группа - и есть центральный ствол человечества. От ствола периодически отходят другие группы, и отправляются погулять, в том числе и в Африку. У некоторых групп - потом даже и M91 исчезает, например у группы A. Это разумеется возможно.

Более того: теоретически - аналогичная мутация может произойти у любого из нас, причём в любой момент, в любой гаплогруппе. Но это же не STR, это SNP !!!
т.е. вероятность такого события - очень мала. За всю историю рода Homo - это произошло лишь однажды (у группы A). И уж обратная мутация SNP у той же самой !!! группы, да ещё почти сразу же (по временнЫм меркам) после прямой мутации - это ничтожно малая вероятность. Это как если бы мы подкинули десять миллионов нуклеотидов в воздух, и один из них - не упал, а воздухе завис; а затем мы подкинули десять миллионов нуклеотидов ещё раз, и (о чудо) - в воздухе завис ... тот же самый нуклеотид.

4. Если копнуть ещё глубже, т.е. почитать первоисточники, на которые ссылается Fulvio Cruciani,
то выясняется, что все его слова о "нестабильности" SNP M91 - не более чем "наукообразие", проще говоря - лапша на уши. Выясняется, что и возраст 30 лет и возможность мутации SNP "туда-сюда" - он якобы обосновывает вот этой работой:
http://www.cell.com/current-biology/fullte...9822(09)01454-7

Которая разумеется о совсем другом, а не о возможности мутаций SNP "туда-сюда",
и вообще - очень спорна и по сути и по исполнению.
Т.е. для оправдания своей догматики - Fulvio Cruciani нашёл работу, где просто наблюдается совпадение с его собственной догматикой по цифре скорости 3.0 х 10-8. Самое забавное, что в указанной работе возраст поколения 30 лет - показан на двух СОВРЕМЕННЫХ людях.
Т.е. мы возвращаемся к нашим же баранам: категорически нельзя переносить образ жизни современных людей, в том числе и тот факт, что современные люди затягивают с рождением детей - на древние времена, когда люди жили совсем по другому.

5. Негативное впечатление от работы Fulvio Cruciani ещё и в том, что он не просто "изящно сфальсифицировал" - он ещё и указал метОду для последователей, для дальнейшей догматизации ДНК-генеалогии. Он ведь не девочка, впервые услышавшая про "митохондриальную Еву" - он понимает, что гаплотипов становится всё больше, в том числе и в корневых группах A и BT; он понимает, что постепенно выявляются очень редкие гаплотипы в этих группах. И вот для того чтобы последователи - нечаянно не обнаружили коренное противоречие на основе самостоятельного анализа новых редких гаплотипов - Fulvio Cruciani предлагает метод "присаживания" группы BT на дерево группы A.
aklyosov
Хммм... Кто Вы, доктор Зорге? (С)

Рассмотрение проведено вполне грамотно, и наводит на мысль, что здесь не случайный новичок.

Только вчера и сегодня я немного порубился именно по этому вопросу на форуме RootsWeb. В качестве спарринга выступали администратор Проекта FTDNA по гаплогруппе А Bonnie Shrack, наш старый знакомый Mayka, немного Ken Nordtvedt, но на этот раз он был даже где-то на моей стороне, хотя ему быть на чьей-то стороне что соляной кислоты напиться. Ну, и по мелочам.

Так вот, статья Крусиани при всей ее полезности обнаружения новых снипов вреда принесла немало. В общем, что Вы здесь и пишете.

Майка повторяет, что Крусиани вообще сделал гигантский вклад и всем обхяснил про гаплогруппу А. С другой стороны, Бонни считает, что у него не хватило смелости назвать вещи своими именами, и он накуролесил с введением и дроблением субкладов, запутав всю картину. Она высказала положение, что всю гаплогруппу А сейчас переделали, и что она перестала быть той, что была, и сейчас представляет наслоение многих субкладов, и что ее вообще-то уже не стоит называть гаплогруппой А, но приходится. Но она (гаплогруппа) ясно показывает, что все люди произошли от африканцев, потому что снипы этой новой "гаплогруппы А" есть у всех гаплогрупп.

Короче, в точности подтвердилось то, что я предсказывал ранней осенью. А именно то, что чтобы спасти положение и продолжать говорить, что все произошли от гаплогруппы А, а значит (!) от африканцев, гаплогруппу А удревнили до альфа-гаплогруппы, и, естественно, ТЕ снипы есть у всех. Могли бы удревнить до шимпанзе, и тогда точно все бы произошли из Африки.

Вот так и Бонни сейчас утверждает, что сначала бьыла гаплогруппа А, по умолчанию африканская, от нее произошла гаплогруппа ВТ, вот и снипы налицо (показываются снипы альфа-гаплогруппы), а от ВТ и все остальные. Гаплогруппа В, естственно, тоже по мнинию Бонни произошла от А.

Я задал Бонни простой вопрос - если В произошла от А, то какое между ними временное расстояние? Ведь должно быть небольшое, если В действительно из А? Вот, говорю, Бонни, когда ответите, тогда продолжим. Они исчезла, и со вчерашнего дня не появляется. Думает, наверное. А это - мат в один ход. Она не знает, что между ними дистанция в 100 тысяч лет, и даже немного больше. То же самое между А и любой другой гаплогруппой. Они просто не могли произойти от А.

Посмотрим, что будет дальше. Все затихли и перестали эту тему обсуждать. Видимо, ждут ответа Бонни.



Igor1961
Цитата(Right & Midfield @ 13.2.2012, 20:19) *
Самое забавное, что в указанной работе возраст поколения 30 лет - показан на двух СОВРЕМЕННЫХ людях.
Т.е. мы возвращаемся к нашим же баранам: категорически нельзя переносить образ жизни современных людей, в том числе и тот факт, что современные люди затягивают с рождением детей - на древние времена, когда люди жили совсем по другому.

Мысль абсолютно правильная. Но, сказав А, и законно усомнившись, что первенцы в традиционных обществах рождались у 30-летних родителей, надо говорить Б, и добавлять, что в таких обществах семьи были многодетными, а женщины рожали до того возраста, сколько позволяла физиология. В старых русских семьях, к примеру, не столь уж редки были случаи, когда младшие дети оказывались моложе своих родных племянников. Собственно, это был единственный способ избежать вымирания в условиях очень высокого уровня смертности.

Поскольку ДНК-генеалогия работает не с линиями, идущими исключительно по первенцам, а со всей совокупностью родственников, то оперировать она должна с некоторым усредненным счетом по поколениям. Так что 30 лет в этом плане выглядят вполне обосновано не только для современного, но и для патриархального общества.

Если уж на то пошло, то длина поколения вообще не имеет прямого отношения к датировкам. поскольку они вычисляются в КАЛЕНДАРНЫХ годах, а при всех расчетах используется произведение [константа скорости мутации]х[длина поколения]. При калибровке можно задать любую величину для поколения, хоть 1 год, просто изменятся коэффициенты. Используемые в наших (и Животовского wink.gif ) расчетах 25 лет - это всего лишь удобная цифра (1/4 от столетия), которая дает вполне реалистичное представление о точности метода.
aklyosov
Цитата(Igor1961 @ 13.2.2012, 21:28) *
Если уж на то пошло, то длина поколения вообще не имеет прямого отношения к датировкам. поскольку они вычисляются в КАЛЕНДАРНЫХ годах, а при всех расчетах используется произведение [константа скорости мутации]х[длина поколения]. При калибровке можно задать любую величину для поколения, хоть 1 год, просто изменятся коэффициенты.


Это правильно, и это то, что попгенетики никак не могут усвоить. Каждый раз, когда наши методы привносятся на дискуссию, ВСЕГДА находятся те, кто начинают оспаривать наши 25 лет на условное поколение, и начинают предлагать СВОИ величины, причем, что занятно, каждый раз категорично - от 18 лет до 36 лет на поколение, у каждого своя цифра. В них они не сомневаются, они ЗНАЮТ.

Так что здесь дело имеет опять с устройством мозга, с которым ничего поделать нельзя. Приснопамятный П. Золин тоже агрессивно предлагал свои 18 лет на поколение, нимало не задумываясь, что без величины константы скорости мутации эта величина ничего не стоит.

Но я прочитал соображение нашего образованного новичка по-другому, а именно что Крусиани выбрал 30 лет на поколение (хотя попгенетики чаще выбирают 25 лет) только потому, чтобы выйти на величину 140 тысяч лет, которая ему нравилась по его своим соображениям. Если бы он взял, например, 20 лет на поколение, то получил бы 93 тысячи лет до root, что явно мало. Иначе говоря, даже в этом попгенетики каждый раз фальсифицируют, потому что подгоняют.
Igor1961
Цитата(Right & Midfield @ 13.2.2012, 20:19) *
... попытался изящно "притянуть за уши" группу BT к группе A.
... сознательно вводит в формулы расчётов MRCA - значительно завышенный коэффициент возраста поколения - 30 лет.
... вытворяет с деревом SNP
... очень боится некой обратной гипотезы
... все его слова о "нестабильности" SNP M91 - не более чем "наукообразие", проще говоря - лапша на уши.
... он не просто "изящно сфальсифицировал" - он ещё и указал метОду для последователей, для дальнейшей догматизации ДНК-генеалогии.

Чтобы перевести разговор из жанра газетного фельетона в научное русло, постараюсь перечислить имеющиеся на сегодняшний день факты, касающиеся гаплогруппы А. Точнее, того, что этой аббревиатурой называют.

Факт № 1. Африка - это континент, на котором в Y-хромосомных линиях безусловно доминируют различные субклады гаплогруппы Е. Ее происхождение вне Африки, кажется, никто особенно не оспаривает. Когда носители гаплогруппы Е пришли Африку, сказать сложно, но можно достаточно аккуратно оценить, когда начался планомерный рост их численности. Это 6-6,5 тыс. лет назад, что хорошо коррелирует с освоением производящего уклада хозяйства в зоне сахеля.

Факт № 2. Все остальные гаплогруппы африканцев можно считать минорными по отношению к Е, хотя для отдельных популяций случаются выбросы в виде высоких процентов A2 (бушмены), A3 (ряд этносов Эфиопии и Судана) или R1b1c (Камерун).

Факт № 3. Среди жителей Западной Африки и их потомков в Новом Свете (искали тщательнее?) на уровне менее 1 % обнаружилось несколько линий, отстоящих как друг от друга, так и от всех известных гаплогрупп на немыслимые дистанции - 150 тыс. лет до общих предков или даже больше. Даже расчет по медленной панели буксует на таком количестве мутаций.

Факт № 4. У всех этих разрозненных линий есть одна общая черта - G в снипе V221 и С в снипе Р108, те же, что и у шимпанзе. У всех остальных людей там Т и G, соответственно. В текущей классификации ISOGG все эти древние линии скопом записаны как А1, хотя по сути мы, очевидно, имеем дело с реликтами, растущими прямо из "альфа"-гаплогруппы, параллельно остальному человечеству.

Факт № 5. В классификации ISOGG и в научных статьях фигурируют "субклады" гаплогруппы А - А2 и А3, носители которых НЕ ИМЕЮТ снипов гаплогруппы ВТ за исключением тех, что были унаследованы от "альфа"-гаплогруппы и более далеких предков. То есть, А2 и А3 (у обеих 8Т в М91) не являются предками "бета"-гаплогруппы. Это параллельные ей линии, независимо выделившиеся из "альфа"-гаплогруппы. То же самое подтверждают расчеты по медленной панели STR.

Факт № 6. Время расхождения "альфа"-гаплогруппы - 150 тыс. лет назад или больше, время распада "бета"-гаплогруппы - 60-65 тыс. лет назад, времена до общих предков гаплогрупп А2 и А3 оценить пока не удается из-за недостатка данных. Расчету поддается только субклад A3b2, характерный для Африканского Рога, Судана и Аравийского полуострова. Его возраст - те же 6,5 тыс. лет, что и у африканских субкладов гаплогруппы Е.

Факт № 7. В Африке южнее Сахары пока не найдено костных останков людей, живших там в период между распадом "альфа"-гаплогруппы и расхождением сводной гаплогруппы DE на африканскую и азиатскую "половинки" (около 45 тыс. лет назад). Находят следы человеческой деятельности в период с 130000 до 80000 лет назад, в основном в пещерах на территории ЮАР и сопредельных стран, но кто их оставил, неизвестно. Доказательства, что это были анатомически современные люди, отсутствуют. Есть лишь интерпретации, мнения и сенсации, рождаемые журналистами.

Наверное, что-то забыл упомянуть, но для начала хорошо бы найти непротиворечивое объяснение этих 7-ми пунктов. Желательно, с минимумом допущений и тезисов, основанных лишь на чьем-то мнении.
aklyosov
Бонни ушла в невсознанку biggrin.gif

Вместо нее включился Майка, сторонник концепции "из Африки". Посчитал калькулятором Кена по 67-маркерным гаплотипам biggrin.gif и "нашел", что общий предок гаплогрупп А и В жил 70 тысяч лет назад. biggrin.gif

В общем, прришлось ему поставить на вид.

А тем временем дерево гаплогруппы А опять изменили:

http://ytree.ftdna.com/index.php?name=Draft&parent=root

http://www.familytreedna.com/public/Haplog..._A/default.aspx

Туда включили всех, от шимпанзе и выше. Как и предсказывалось ранее на этом Форуме. Это чтобы показать, что все мы "вышли из Африки". Чтобы из гоголевской шинели - это я еще могу понять (хотя и с натяжкой), чтобы из Африки - понять не могу.





Igor1961
Цитата(aklyosov @ 15.2.2012, 21:58) *
А тем временем дерево гаплогруппы А опять изменили:

http://ytree.ftdna.com/index.php?name=Draft&parent=root

http://www.familytreedna.com/public/Haplog..._A/default.aspx

biggrin.gif Есть такая поговорка:"Торопливость нужна лишь при ловле блох и при поносе".

Не прошло и суток, как появились новые снипы N64496 Perry, того самого, у кого DYS438=16 и DYS425=9: L896-, M42-, P97+, SRY10831.1-, V166-, V168-, V50-. То есть, он не вписывается в схему, в которой у самой первой развилки находился участник WTY N38376 Jones (V166+).

Собственно, это можно было предположить из гаплотипа мистера Перри, о чем мы писали в Вестнике в прошлом году. Странно, что его как-то упустили из виду администраторы проекта. Наверное, из-за недоверия к нашим методам подсчета TMRCA. Как выясняется, напрасно.
Right & Midfield
Как бы нам не хотелось, у нас не получается одним постом - ответить сразу на несколько интересных постов от собеседников. Тем не менее, мы постараемся ничего не упустить, постараемся постепенно ответить на все вопросы (на которые сможем, разумеется).

Также предварительно отметим, что дискуссия по поводу корневых гаплопрогрупп - неизбежно приводит нас к необходимости "залезать" и в другие области знаний, ибо суть дискуссии - выходит за рамки непосредственно ДНК-генеалогии. Мы не виноваты в этом - это Fulvio Cruciani виноват, ибо его никто не заставлял переходить от ДНК-генеалогии - к излишне своеобразным трактовкам, и к выводам исторического масштаба и значения.

Цитата(aklyosov @ 14.2.2012, 3:52) *
здесь не случайный новичок

К сожалению, в интернете вообще и в ДНК-генеалогии в частности - слишком много как догматиков, так и популистов. Если бы мы выбирали символ ДНК-генеалогии, то предпочли бы ... вилку-трезубец, символизирующую инструмент, который позволяет чётко разделять сущности надвое: есть мутация/нет мутации.
Но этот же самый инструмент - может быть использован и для навешивания лапши на уши, как ДНК-догматиками, так и ДНК-популистами. И этот же самый инструмент - мы, к счастью, можем использовать для покалывания догматиков и популистов.
Мы здесь - потому что нам импонирует научный подход здесь.
Конечно - это не случайность для нас.

Ещё добавим, что наблюдается использование ДНК-генеалогии - в качестве помощника для сестринской науки - молекулярной филогенетики. А там - есть свои догматики, у которых две ключевых проблемы: где на стволе ставить точку "Род Homo", и где на стволе ставить точку "Вид Homo Sapiens". К сожалению, ДНК-генеалогия оказывается вовлечена в эту баталию, хотя не может и не должна решать такие вопросы; это скорее дело аналитиков антропологии, морфологии, генома в целом...
Нам конечно тоже интересно посмотреть, чем там у них всё закончится да и их знания пригодятся, но мы вынуждены отметить, что догматики от разных наук - могут объединять усилия, и совместно вешать нам лапшу на уши.

Цитата(Igor1961 @ 14.2.2012, 6:28) *
Если уж на то пошло, то длина поколения вообще не имеет прямого отношения к датировкам. поскольку они вычисляются в КАЛЕНДАРНЫХ годах, а при всех расчетах используется произведение [константа скорости мутации]х[длина поколения]. При калибровке можно задать любую величину для поколения, хоть 1 год, просто изменятся коэффициенты. Используемые в наших (и Животовского wink.gif ) расчетах 25 лет - это всего лишь удобная цифра (1/4 от столетия), которая дает вполне реалистичное представление о точности метода.

Что ж, если нас поняли не так, как нам самим хотелось бы - постараемся объясниться с самого начала, с нашего понимания сути явлений.

Мутация нами понимается как дискретная величина! Она либо есть, либо нет. Чтобы она возникла - необходимо конкретное событие - рождение ребёнка, которого можно проверить на соответствие с родителем. Мутация не накапливается в организме ежегодно "по чуть-чуть". Вероятностные события (смена поколений) - не могут быть напрямую связаны с размышлениями генетиков о том, с какой скоростью в год - мутируют белки.
Да, конечно, когда "модель работает", то изменение возраста поколения - выглядит как вмешательство в формулу, в саму скорость мутации. Но это не так.

Мы привыкли разбираться не только в математике - мы стремимся понять "физический смысл", скрывающийся за результатом и его составными частями.
Когда мы видим общее время на одну мутацию, равное 3000 лет у того же Fulvio Cruciani,
полученное как ~100 поколений х ~30 лет, то разбираясь с тем, как он пришёл к такому выводу - мы сталкиваемся с генетическим смыслом скорости мутаций в год, сталкиваемся с соотношением количества нуклеотидов, сталкиваемся с тем фактом, что скорость мутации в год - не есть константа. Просто в данный момент - так принято, ибо примерно проверяется на краткосрочных математических моделях. Когда генетики покажут, что скорость мутации на нуклеотид в год - должна измениться так или иначе, то и мы последуем вслед за ними.

Т.е. - мы не "сотрясаем основ", по крайней мере пока, ибо эти контстанты - отдельная тема для разговора; они обычно исследуются генетиками на примере скоростей кодирования разных белков, а ДНК-генеалогия - зиждется на невмешательстве в наследственность вообще, и в кодирование белков в частности. У нас просто происходят аналогичные, но "мусорные", "молчащие" процессы. Не факт, что с теми же скоростями.
Однако, Fulvio Cruciani тоже не "сотрясает основ", тоже "импортирует" из генетики - скорость мутации в год.
Хотя соблазн был велик - ведь ему было нужно "натянуть" всего лишь 20% между стандартными значениями 30 лет и 25 лет, и он мог бы оставить 25 лет - слегка подкорректировав генетикиов на те же 20%. Но тогда ему пришлось бы с ними аргументированно спорить, чего он разумеется делать не мог и не стал.

И мы - не станем.
Для приблизительной оценки нас устраивает ~100 дискретных поколений на одну точечную SNP мутацию.
Для нас это (условно говоря) - "минутная стрелка" ДНК-генеалогии, её макро-уровень.
Проблема в том, что как мы не анализируй общество и его способы размножения, как не предполагай разные возрасты для поколений (10 ... 30 лет) - мы сможем оперировать только длинными периодами (1000 ... 3000 лет, соответственно). И например по "женской части" - вообще нет возможности анализировать "мелкие" периоды.
К счастью, царским подарком для исследователей - является анализ STR мутаций.
Для нас это (условно говоря) - "секундная стрелка" ДНК-генеалогии, её микро-уровень.
Они происходят по другому принципу, происходят гораздо чаще;
их анализ - помогают делать многие другие науки: письменная история, недавние предания народов и их древние мифы, сравнительное языкознание и т.п.

В то время как у "минутной стрелки" - остаётся не так уж много, и не таких уж точных помощников, особенно в отдалённом периоде - архелогия, палеонтология, теория катастроф... всё это базируется на радиоуглеродном анализе, дающим существенный "плюс-минус" - примерно одну нашу условную "минуту".
Так например, глобальная катастрофа Тоба - обычно датируется в 73 +/-3 тлн. Помещать мужскую гаплогруппу BT на дату 75 тлн, используя натяжку в 20% - это существенное передёргивание. Без этого было бы по крайней мере 62,5 тлн (при возрасте поколения 25 лет) - а значит невозможность связать в единое географическое убежище группы BT и A, а значит бессмысленность игры в перекидывание SNP по веткам дерева. Не невозможность манипуляций, а именно бессмысленность - вулканическая зима, при всей своей трагичности - это очень хороший помощник макро ДНК-генеалогии; строго разделяет.

ДНК-генеалогия - наука молодая, находится на этапе сбора первичных данных. И именно анализ STR мутаций - позволяет нам вырабатывать математический аппарат. Оттачивать его на событиях заведомо известного или почти достоверного недавнего прошлого, т.е. несколько тлн; кстати - опять-таки примерно в пределах одной нашей условной "минуты" ~100 поколений. И этот математический аппарат - нам хочется перенести в глубь истории, тем более что наша наука в целом - не так давно получила новые возможности от матери-генетики - возможности извлекать ДНК из ископаемых останков, что раньше считалось невозможным.

Однако мы наблюдаем, что наш математический аппарат - постепенно "удревняет" историю, чем глубже - тем сильнее, мало того - позволяет удревнять и манипуляторам от ДНК-генеалогии.
Нас вполне устраивает, когда на определённом небольшом временном интервале - ошибка по сравнению с абсолютно точно известными датами - укладывается в погрешность математического аппарата. Мы понимаем, что сбой в несколько процентов - мог дать как сам аппарат, так и немного некорректные входные данные: слегка завышенный возраст поколения или слегка завышенная скорость мутации нуклеотидов. Не стоит беспокойства - мы достверно знаем, что в последние тысячелетия - общество развивалось по одной и той же модели; не стоит наших глобальных усилий - ловить ошибку в несколько процентов.
Но мы вынуждены искать ошибки у самих себя; не для того чтобы конфликтовать между собой константами, математическими аппаратами и т.п. - а для того чтобы аргументированно оппонировать "внешней угрозе", т.е. догматикам в первую очередь, ибо популистов опровергать полегче.

Цитата(Igor1961 @ 14.2.2012, 6:28) *
1. Поскольку ДНК-генеалогия работает не с линиями, идущими исключительно по первенцам, а со всей совокупностью родственников, то оперировать она должна с некоторым усредненным счетом по поколениям.
2. Так что 30 лет в этом плане выглядят вполне обосновано не только для современного, но и для патриархального общества.

1. Разумеется да.
2. Разумеется нет. Любая математическая модель - имеет временнЫе рамки, отражая модель общества.
Ни отдельные дисциплины, ни наука в целом - не могут объяснить, как появились кроманьонцы и их новая модель общества.
Даже популисты в википедиях признаются: "Считается, что люди современного анатомического облика (Homo sapiens sapiens) появились около 195 000 лет назад в Африке. Однако их внешний вид не стал причиной изменения их образа жизни по сравнению с эректусами и неандертальцами. Люди по-прежнему использовали все те же грубые каменные орудия. Около 50 000 лет назад древняя каменная индустрия изменилась."

Цитата(Igor1961 @ 14.2.2012, 6:28) *
Мысль абсолютно правильная. Но, сказав А, и законно усомнившись, что первенцы в традиционных обществах рождались у 30-летних родителей, надо говорить Б, и добавлять, что в таких обществах семьи были многодетными, а женщины рожали до того возраста, сколько позволяла физиология.

Мы опять стремимся понять в первую очередь смысл этой составляющей общей формулы.
Мы наблюдаем два фактора: биологический и социальный.
Биологический зависит от пола. Причём надо говорить не только про:
a ) усреднённый возраст поколения,
b ) возраст рождения первого потомка,
но и про
c ) возраст рождения последнего потомка.

Общеизвестно, что репродуктивный возраст у мужчин - заметно выше.
Значит должен быть выше и усреднённый возраст поколения (у мужчин в сравнении с женщинами).
Но к сожалению у женской mt-DNA отсутсвует "секундная" стрелка, и мы не можем сегодня же наглядно показать, что некорректно считать оба пола по 25 лет.
Мало того - мы предполагаем, что возраст поколения будет расти у обоих полов, но у мужчин - будет увеличиваться немного быстрее чем у женщин, уходя таким образом ещё дальше к возрасту рождения последнего ребёнка.

Социальный фактор - это наш образ жизни. Он был у нас таким не всегда.
Мы предполагаем, что кроманьонцы поначалу ничем не отличались от соседей по среднему палеолиту.
Потом возраст поколения начал постепенно расти и растёт до сих пор, отвлекаясь от тренда может быть иногда - на катастрофы и прочие неурядицы.

Цитата(Igor1961 @ 15.2.2012, 17:29) *
Не прошло и суток, как появились новые снипы

Для нас нет ничего удивительного в том, как ими теперь играются. Мы в своём первом посте так и предполагали, сорри за самоцитату: "Негативное впечатление от работы Fulvio Cruciani ещё и в том, что он не просто "изящно сфальсифицировал" - он ещё и указал метОду для последователей, для дальнейшей догматизации ДНК-генеалогии. Он ведь не девочка, впервые услышавшая про "митохондриальную Еву" - он понимает, что гаплотипов становится всё больше, в том числе и в корневых группах A и BT; он понимает, что постепенно выявляются очень редкие гаплотипы в этих группах. И вот для того чтобы последователи - нечаянно не обнаружили коренное противоречие на основе самостоятельного анализа новых редких гаплотипов - Fulvio Cruciani предлагает метод "присаживания" группы BT на дерево группы A."
В.Юрковец
К нам инкогнито приехал(и) ревизор(ы) из Москвы? Или наоборт - это статья вывешена на рецензию?
Что скажут наши уважаемые мэтры?
Igor1961
Честно говоря, не смог уловить главную мысль автора (авторов?) многословного поста.

Если она заключается в том, что по мере ухода вглубь по шкале времени длина поколения в человеческом роду уменьшалась, причем в разы (?), то ничего, кроме общих соображений, в тексте не увидел. Хотелось бы ознакомиться с цифрами, фактами (скажем, из этнографии) или хотя бы математической моделью. Помнится, не так давно один новичок с пеной у рта отстаивал гипотезу, что у представителей черной расы мутации в Y-хромосоме идут в 2 или более раза быстрее, чем у европеоидов. Правда, ни одной цифры в свою поддержку привести не смог - только манипуляции.

Если пафос направлен против тех, кто якобы манипулирует с отнесением новых снипов, то он оправдан лишь частично, в плане интерпретаций. К фактической стороне особых претензий нет. На многих примерах уже показано, что SNP и STR филогения дают качественно одну и ту же топологию деревьев, так что "мухлеж" со снипами тут же бы раскрылся. Африканцы, о которых шла речь, действительно расходятся с остальным человечеством на огромные дистанции. Даже если допустить, что поколения у них обновлялись каждые 15-20 лет, цифра уверенно уходит за 100 тыс. лет назад. Это факт, который можно опровергнуть более убедительным фактом, а не общими словами.

Собственно, чуть выше я выписал 7 более-менее надежных фактов, касающихся африканских Y-хромосомных линий и предложил сверить свои концепции с ними. Пока что такой работы не увидел.
казак
>Так например, глобальная катастрофа Тоба - обычно датируется в 73 +/-3 тлн. Помещать мужскую гаплогруппу BT на дату 75 тлн, используя натяжку в 20% - это существенное передёргивание. Без этого было бы по крайней мере 62,5 тлн (при возрасте поколения 25 лет) - а значит невозможность связать в единое географическое убежище группы BT и A, а значит бессмысленность игры в перекидывание SNP по веткам дерева. Не невозможность манипуляций, а именно бессмысленность - вулканическая зима, при всей своей трагичности - это очень хороший помощник макро ДНК-генеалогии; строго разделяет.

[/font][font="Verdana"]Получить другую дату при возрасте 20 лет на поколение - это и есть передергивание. Отношение возраст/поколение может применяться в формулах учета количества населения, но не в етоде ДНК-генеологии, где имеется пока единственная возможность определить возраст исходя из даты известного события, разделенной на количество мутаций.

Кроме того, корректировка возраста в отношении события, имеющего слабую историческую подтвержденность (вулканическая зима), определенного с помощью неоткалиброванного метода (радиоуглеродный анализ длинного времени) и имеющего малую вероятность взаимосвязи (Тоба, как причина вулканической зимы) может стать причиной глобальной ошибки, ставящей под сомнение как метод ДНК-генеологии, так и науку в целом.

Right & Midfield
Цитата(aklyosov @ 14.2.2012, 13:48) *
Но я прочитал соображение нашего образованного новичка по-другому, а именно что Крусиани выбрал 30 лет на поколение (хотя попгенетики чаще выбирают 25 лет) только потому, чтобы выйти на величину 140 тысяч лет, которая ему нравилась по его своим соображениям. Если бы он взял, например, 20 лет на поколение, то получил бы 93 тысячи лет до root, что явно мало. Иначе говоря, даже в этом попгенетики каждый раз фальсифицируют, потому что подгоняют.

По сути - совершенно верно: фальсифицируют, потому что подгоняют.
Только событие другое - появление мужской группы BT якобы ДО катастрофы Тоба.

Цитата(aklyosov @ 14.2.2012, 3:52) *
Я задал Бонни простой вопрос - если В произошла от А, то какое между ними временное расстояние? Ведь должно быть небольшое, если В действительно из А? Вот, говорю, Бонни, когда ответите, тогда продолжим. Они исчезла, и со вчерашнего дня не появляется. Думает, наверное. А это - мат в один ход. Она не знает, что между ними дистанция в 100 тысяч лет, и даже немного больше. То же самое между А и любой другой гаплогруппой. Они просто не могли произойти от А.

Не только временнАя дистанция большая - ещё и географическая.
Это ещё один "камень преткновения", очень серьёзный, но малозаметный "из снипов".

Мы предполагаем, что разделение предковых групп альфа и бета - произошло гораздо раньше,
возможно около 150-130 тлн. Разделились они и географически. И не могли попасть друг к другу.
На наш взгляд - предковые группы были надолго разделены вклиниванием более сильных на тот момент неандертальцев, которые заняли Ближний Восток по направлению движения из Малой Азии к Персидскому Заливу.
Таким образом, те кто успел уйти за эту воображаемую линию (предковая группа бета) - жили севернее и/или восточнее. А те кто не успел (прековая группа альфа) - остались в Северной Африке/Южной Аравии.

Затем обе предковые группы почти вымерли, но
от предковой группы бета - не осталось реликтовых следов среди ныне живущих (либо мы ещё не нашли таких следов),
а от предковой группы альфа - следы среди ныне живущих сохранились, хоть и немного.
И вот только затем была ещё одна катастрофа - извержение вулкана Тоба.
Которую BT и A - встретили в разных местах. Причём ещё долго не могли попасть друг к другу.
Резко и надолго - наступили холода.
Предковая группа альфа - потянулась к югу где и сформировалась собственно группа А (плюс реликтовые остатки предковой группы альфа).

Если же принять альтернативную точку зрения Fulvio Cruciani, то всё срастается очень удобно (якобы):
BT появилась "незадолго" до катастрофы Тоба, разумеется "где-то в Африке" и разумеется "от африканской группы А", катастрофу BT и A - пережидали в одном убежище, а потом - группа BT ушла в Азию. Только вот реликтовые SNP предковой группы альфа - мешаются под ногами у Fulvio Cruciani.
Их надо куда-то девать, а то они-то как раз - древние.
Вот и начинаются игры со "снипами".

Цитата(aklyosov @ 15.2.2012, 16:58) *
Вместо нее включился Майка, сторонник концепции "из Африки". Посчитал калькулятором Кена по 67-маркерным гаплотипам biggrin.gif и "нашел", что общий предок гаплогрупп А и В жил 70 тысяч лет назад. biggrin.gif

А это ужЕ совсем детская попытка: раз слишком неправдоподобно помещать дату появления группы BT до катастрофы Тоба - умолодим группу А так, чтобы обе группы были немножко моложе катастрофы Тоба и скажем, что это означает,
будто их общий предок пережидал катастрофу в одном и том же убежище (конечно же в Африке); а потом группа BT ушла в Азию.

Цитата(Igor1961 @ 15.2.2012, 21:42) *
Собственно, чуть выше я выписал 7 более-менее надежных фактов, касающихся африканских Y-хромосомных линий и предложил сверить свои концепции с ними. Пока что такой работы не увидел.

Мы просто не успеваем всё сразу, сорри.
Много интересных ответов от собеседников, и от Вас тоже.

Цитата(Igor1961 @ 14.2.2012, 14:26) *
1. Чтобы перевести разговор из жанра газетного фельетона в научное русло,
2. постараюсь перечислить имеющиеся на сегодняшний день факты, касающиеся гаплогруппы А. Точнее, того, что этой аббревиатурой называют.

1. Нас немного забавляет поход догматиков "африканской гипотезы", таких как Fulvio Cruciani. Поэтому наш язык не всегда строго научен по отношению к нему.
2. Спасибо за коллекцию. Однако мы не наблюдаем противоречий в изложенных первых 1-5 постулатах.
Для сторонников Fulvio Cruciani - противоречия там есть, а для нас - нет.
Надо просто аккуратно SNP расставлять, по крайней мере исходя и из "братской" гипотезы тоже.

Цитата(Igor1961 @ 14.2.2012, 14:26) *
Факт № 6
Время расхождения "альфа"-гаплогруппы - 150 тыс. лет назад или больше, время распада "бета"-гаплогруппы - 60-65 тыс. лет назад...

Факт № 7
В Африке южнее Сахары пока не найдено костных останков людей, живших там в период между распадом "альфа"-гаплогруппы и расхождением сводной гаплогруппы DE на африканскую и азиатскую "половинки" (около 45 тыс. лет назад).

Факт № 8
Находят следы человеческой деятельности в период с 130000 до 80000 лет назад, в основном в пещерах на территории ЮАР и сопредельных стран, но кто их оставил, неизвестно. Доказательства, что это были анатомически современные люди, отсутствуют. Есть лишь интерпретации, мнения и сенсации, рождаемые журналистами.


6. Мы несколько иначе видим картину. 65-60 тлн это не время распада предковой бета-группы - это (хоть и завышенное на наш взгляд) - время распада группы BT. В период между 150-130 тлн и 65-60 тлн - предковая группа бета должна была где-то обретаться. Мы предполагаем, что севернее и/или восточнее линии вклинивания неандертальцев.

7. Если так и не найдут, мы окончательно убедимся, что проход из Северной Африки/Южной Аравии (где по нашему предположению и обреталась предковая группа альфа) - был закрыт.
То есть этот постулат - не только не противоречит - наоборот подтверждает наши соображения.

Мы в самом первом посте потому и говорили, что нам неважно, откуда был сам Y-DNA Адам. Может быть и из Африки. Может быть предковая бета группа вышла из Африки, а потом её отрезали от предковой альфа группы неандертальцы...
Но может быть и наоборот. Мы потому и высказывали гипотезу, что от центрального ствола - периодически отходят группы и направляются гулять по свету, в том числе и в Африку.
Какая собственно разница - откуда именно сам наш общий первопредок Y-DNA Адам?
Если кому-то легче, то мы готовы не отвергать гипотезу о том, что Адам - из Африки.

Но мы же ищем ответ не на этот вопрос! Мы ищем ответ на вопрос: из какого "ниоткуда" - 50 тлн появилась группа BT, т.е. откуда произошло подавляющее большинство человечества?

8. Сорри, что выделил восьмой постулат. Он не противоречит ничему - просто очень интересный. К сожалению да - у нас тоже только версии, даже не предположения. Мы в общем, методологически - считаем что после катастрофы Тоба (как и после любого другого "угольного ушка") приматы, в том числе люди, в том числе сапиенсы - могли выжить где угодно, но в очень ограниченных количествах, и самое главное - не обязательно в одном месте.

Например среди выживших и оставивших потомство достаточно надолго - были:
неандертальцы, денисовцы, хоббиты,
ещё какие-то индйские ребята оставили примитивные инструменты как под, так и над многометровым слоем пепла,
как минимум одна группа сапиенсов (с нашей точки зрения - как минимум две).
Как говорится - раз-два-несколько...

Мы разумеется не имеем права утверждать, что в Южно-Африканском убежище - выжили именно сапиенсы, мало того - сохранились их потомки до наших дней, мало того - это такие потомки, предки которых отделились от ствола 150-130 тлн, и это именно их гаплотипы - реликтово наблюдаются нами сейчас. Ну вот мол - такое удачное у них убежище - во все катастрофы спасает...
Но это могли быть совсем не сапиенсы, а если и сапиенсы, то могли не оставить потомков.
Так что - третье убежище сапиенсов - пока лишь умозрительная версия, не более.
Для просмотра полной версии этой страницы, пожалуйста, пройдите по ссылке.
Форум IP.Board © 2001-2019 IPS, Inc.